Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 8, Number 3—March 2002

Research

Eastern Equine Encephalomyelitis Virus Infection in a Horse from California

Robert P. Franklin*Comments to Author , Hailu Kinde†, Michele T. Jay‡, Laura D. Kramer†, Emily-Gene N. Green†, Robert E. Chiles†, Eileen Ostlund§, Stan Husted‡, Jonathan Smith¶, and Michael D. Parker¶
Author affiliations: *Humphrey, Giacopuzzi & Associates Equine Hospital, Somis, California, USA †University of California Davis, Davis, California, USA; ‡California Department of Health Services, Sacramento, California, USA; §National Veterinary Service Laboratory, Ames, Iowa, USA; ¶U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Maryland, USA;

Main Article

Table 1

Reverse transcriptase-polymerase chain reaction (RT-PCR) primers used to sequence Eastern equine encephalomyelitis virus RNA

Title Sense Primer Use Region
9930 Forward 5´- GCGCTGCTTATTTTGCTGT -3 RT-PCR E1
11582 Reverse 5´- ATTATGCGCTGCCTGTAGTGTTTA –3´ RT-PCR E1
4043 Forward 5´- GTGCGCGGCGACATAACAAAGAG- 3´ RT-PCR NSP3
4976 Reverse 5´- CCGGGGGTACAGTGCCAGAGAA –3´ RT-PCR NSP3
10470 Forward 5´- ATGCCAAACTCATCATAGGTCCACT –3´ Sequencing E1
10938 Forward 5´- GTATAGCCACCGTTGCCTACAAATC –3´ Sequencing E1
11345 Forward 5´- CAGGCAGTGTATAAGGCTGTCTTAC –3´ Sequencing E1
T3 Forward 5´- AATTAACCCTCACTAAAGGGA –3´ Sequencing NSP3

Main Article

TOP