Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 8, Number 4—April 2002

Research

Introduction of West Nile Virus in the Middle East by Migrating White Storks

Mertyn Malkinson*Comments to Author , Caroline Banet*, Yoram Weisman*, Shimon Pokamunski†, Roni King‡, Vincent Deubel§, and Marie-Thrse Drouet
Author affiliations: *Kimron Veterinary Institute, Beit Dagan, Israel; †Veterinary Services and Animal Health, Beit Dagan, Israel; ‡Nature and Parks Authority, Jerusalem, Israel; §Pasteur Institute, Lyon, France;

Main Article

Table 2

Oligonucleotide primers used for framing the entire West Nile virus (WNV)a genome and the envelope (E) gene, Israel 98—ST1

Localization in the WNV genome N° nucleotide at the 5′ end Sequence
5′ -end 1 AGTAGTTCGCCTGTGTGAGCTGACAAAC
3′ -end 10,934 (c) AGATCCTGTGTTCTCGCACCACCAGCCAC
M-gene 889 GGATGGATGCTWGGKAGCAAC
NS1-gene 2,557 (c) CCATCCAAGCCTCCACATC

(c)=complementary sequence; W=(A+T); K=(G+T).

Main Article

TOP