Volume 8, Number 8—August 2002
Research
Genetic Characterization of Hantaviruses Transmitted by the Korean Field Mouse (Apodemus peninsulae), Far East Russia
Table 1
Primers used for reverse transcription-polymerase chain reaction and/or sequencing of S and M genome segments of hantaviruses
| Gene | Primer name | Primer sequence (5´–3´) | Position |
|---|---|---|---|
| S segment | M13 Fw | ctggccgtcgttttac | |
| PEN 215 S Fw | gaattgaaagacaattggc | 215–233 | |
| KPS3a | tc(a/c)agcatgaaggc(a/t)gaagagat | 592–703 | |
| PEN 780 SFw | acagaggcaggcagctttag | 780–799 | |
| PEN 1042 S Fw | gcaggatatgcggaatacaa | 1042–1061 | |
| HTNV 1390 S Fw | attgcactattattatcagg | 1390–1409 | |
| HTNV Full S | ttctgcagtagtagtag(t)a(g)ctccctaa | ||
| PEN180 S Rv | ttccctgtctgttaatgctc | 180–199 | |
| PEN 585 S Rv | tgggcaaggacacatagaga | 585–604 | |
| PEN 946 Rv | atgatggtgactcgatgtct | 946–965 | |
| PEN 1160 S Rv | gttgtattcccattgactgt | 1160–1179 | |
| HTNV 1493 SRv | cacccacaacggattaactg | 1493–1512 | |
| M13 Rv | caggaaacagctatgac | ||
| M segment | HS1a | ac(a/c)tgtca(c/a)tttgg(a/t)gaccc | 2636–2655 |
| HS2a | tcaca(g/a)gcctttattga(g/t)gt | 3072–3091 | |
| HS3a | t(t/c)aggaa(ga)aaatg(tc)aactttgc | 2715–2736 | |
| HS4a | acacc(a/t)gaaccccaggc(a/c)cc | 3000–3019 | |
| M13 Fw | ctggccgtcgttttac | ||
| M13 Rv | caggaaacagctatgac |
aPrimers designed by Yashina et al.


