Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 9, Number 10—October 2003

Dispatch

West Nile Virus Encephalitis and Myocarditis in Wolf and Dog

Carol A. Lichtensteiger*Comments to Author , Kathleen Heinz-Taheny*, Tanasa S. Osborne*, Robert J. Novak*, Beth A. Lewis*, and Margaret L. Firth†
Author affiliations: *University of Illinois, Champaign-Urbana, Illinois, USA; †Town and Country Animal Hospital, Normal, Illinois, USA

Main Article

Table

Sequence (5´ to 3´) of primers and probes used in real-time reverse transcriptase–polymerase chain reaction to assay for West Nile virus genome in canid tissue

Item West Nile virus St. Louis encephalitis virus
Forward primer CAGACCACGCTACGGCG GAAAACTGGGTTCTGCGCA
Reverse primer CTAGGGCCGCGTGGG GTTGCTGCCTAGCATCCATCC
Probe TCTGCGGAGAGTGCAGTCTGCGAT TGGATATGCCCTAGTTGCGCTGGC

Main Article

TOP