Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 9, Number 7—July 2003

Research

Antimicrobial Resistance Markers of Class 1 and Class 2 Integron-bearing Escherichia coli from Irrigation Water and Sediments

Matthew T. Roe*, Everardo Vega*, and Suresh D. Pillai*Comments to Author 
Author affiliations: *Texas A&M University, College Station, Texas, USA

Main Article

Table

Oligonucleotide primer sequences used for amplification of class 1 and class 2 integrase and variable regions

Primer Primer sequence Target Reference
integ-1 5'-GGCATCCAAGCAAG-3' 5'-Class 1 integron variable region Levesque et al. 1995 (13)
integ-2 5'-AAGCAGACTTGACCTGA-3' 3'-Class 1 integron variable region Levesque et al. 1995 (13)
hep51 5'-GATGCCATCGCAAGTACGAG-3' 5'-Class 2 integron variable region White et al. 2001 (14)
hep74 5'-CGG
GATCCCGGACGGCATGCACGATTT
GTA-3' 3'-Class 2 integron variable region White et al. 2001 (14)
intI1.F 5'-GGGTCAAGGATCTGGATTTCG-3' 5'-intI1 gene Mazel et al. 2000 (15)
intI1.R 5'-ACATGGGTGTAAATCATCGTC-3' 3'-intI1 gene Mazel et.al. 2000 (15)
intI2.F 5'-CACGGATATGCGACAAAAAGGT-3' 5'-intI2 gene Mazel et al. 2000 (15)
intI2.R 5'-GTAGCAAACGAGTGACGAAATG-3' 5'-intI2 gene Mazel et al. 2000 (15)

Main Article

TOP