Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 7, Number 1—February 2001
Research

A Flea-Associated Rickettsia Pathogenic for Humans

Didier Raoult*Comments to Author , Bernard La Scola*, Maryse Enea*, Pierre-Edouard Fournier*, Véronique Roux*, Florence Fenollar*, Marcio A.M. Galvao†, and Xavier de Lamballerie*
Author affiliations: *Unité des Rickettsies, CNRS UPRESA 6020, France; †Ouro Preto Federal University, Brazil

Main Article

Table 1

Primers used for PCR amplification and sequencing of the ELB agent strain Marseille-URRWFXCal2

Gene position relative
Gene Primer Nucleotide sequence (5'-3')  to open reading frame Reference
17 kDa 
antigen 17kDFa GCTCTTGCAACTTCTATGTT 31-50 This manuscript
17KdRa CATTGTTCGTCAGGTTGGCG 464-445 This manuscript
Citrate
synthase CSFEL1a TGATTCAGAATTTGCCGAAT 21-40 17
CS890ra GCTTTAGCTACATATTTAGG 890-871 17
CS532ra GCCGCAATGTCTTATAAATATTCT 532-555 This manuscript
CS1273ra CATAACCAGTGTAAAGCTG 1273-1255 This manuscript
CS244rb CTTTAATATCATATCCTCGAT 244-224 17
Rp877Pb GGGGACCTGCTCACGGCGG 797-815 18
rOmpB 120-M59a CCGCAGGGTTGGTAACTGC M59-M41 This manuscript
120-807a CCTTTTAGATTACCGCCTAA 807-788 This manuscript
120-607a AATATCGGTGACGGTCAAGG 607-626 This manuscript
120-1497a CTATATCGCCGGTAATT 1497-1480 This manuscript
120F-1351a TTTAGGAAACGCTGGTTCTC 1351-1370 This manuscript
120F-2934a GCGTTAGTTGCGATAATACT 2934-2915 This manuscript
120-2788a AAACAATAATCAAGGTACTGT 2788-2808 This manuscript
120-3599a TACTTCCGGTTACAGCAAAGT 3599-3579 This manuscript
120F-3440a GTTAATGCAACAACTACGGG 3440-3459 This manuscript
120F-4341a GCATCGAAGAAGTAACGCTG 4341-4322 This manuscript
120-4232a GGTTTCTCATTCTCTCTATATGG 4232-4254 This manuscript
120-4879a TTAGAAGTTTACACGGACTTT 4879-4857 This manuscript
120F-1749b CTATTAGTGGTAATATTGGTAC 1749-1770 This manuscript
120F-2495b CATGGTCATTACCTGCATTACC 2495-2481 This manuscript
120-4489b GTCTTCTGACGAAAACTACAA 4489-4509 This manuscript
ROmpA 190-70a ATGGCGAATATTTCTCCAAAA 70-90 18
190-701a GTTCCGTTAATGGCAGCATCT 701-681 19

aPrimers used for both PCR amplification and sequencing of the ELB agent strain Marseille-URRWFXCal2.
bPrimers used only for sequencing.

Main Article

References
  1. Raoult  D, Roux  V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997;10:694719.PubMedGoogle Scholar
  2. Adams  JR, Schmidtmann  ET, Azad  AF. Infection of colonized cat fleas, Ctenocephalides felis (Bouché), with a rickettsia-like microorganism. Am J Trop Med Hyg. 1990;43:4009.PubMedGoogle Scholar
  3. Higgins  JA, Radulovic  S, Schriefer  ME, Azad  AF. Rickettsia felis: a new species of pathogenic rickettsia isolated from cat fleas. J Clin Microbiol. 1996;34:6714.PubMedGoogle Scholar
  4. Zavala-Velasquez  JE, Sosa-Ruiz  JA, Zavala-Castro  J, Jimenez-Delgadillo  B, Vado-Solis  IE, Sanchez-Elias  RA, Rickettsia felis: the etiologic agent of three cases of rickettsiosis in Yucatan. Lancet. 2000;356:107980.PubMedGoogle Scholar
  5. Azad  AF, Sacci  JB, Nelson  WM, Dasch  GA, Schmidtmann  ET, Carl  M. Genetic characterization and transovarial transmission of a typhus-like rickettsia found in cat fleas. Proc Natl Acad Sci U S A. 1992;89:436. DOIPubMedGoogle Scholar
  6. Schriefer  ME, Sacci  JB Jr, Dumler  JS, Bullen  MG, Azad  AF. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J Clin Microbiol. 1994;32:94954.PubMedGoogle Scholar
  7. Azad  AF, Radulovic  S, Higgins  JA, Noden  BH, Troyer  JM. Flea-borne rickettsioses: ecologic considerations. Emerg Infect Dis. 1997;3:31927. DOIPubMedGoogle Scholar
  8. Radulovic  S, Higgins  JA, Jaworski  DC, Dasch  GA, Azad  AF. Isolation, cultivation, and partial characterization of the ELB agent associated with cat fleas. Infect Immun. 1995;63:48269.PubMedGoogle Scholar
  9. Radulovic  S, Higgins  JA, Jaworski  DC, Azad  AF. In vitro and in vivo antibiotic susceptibilities of ELB rickettsiae. Antimicrob Agents Chemother. 1995;39:25646.PubMedGoogle Scholar
  10. Trilar  T, Radulovic  S, Walker  DH. Identification of a natural cycle involving Rickettsia typhi infection of Monopsyllus sciurorum sciurorum fleas from the nests of the fat dormouse (Glis glis). Eur J Epidemiol. 1994;10:75762. DOIPubMedGoogle Scholar
  11. La Scola  B, Raoult  D. Diagnosis of Mediterranean spotted fever by cultivation of Rickettsia conorii from blood and skin samples using the centrifugation-shell vial technique and by detection of R. conorii in circulating endothelial cells: a 6-year follow-up. J Clin Microbiol. 1996;34:27227.PubMedGoogle Scholar
  12. Pudney  M, Varma  MG, Leake  CJ. Establishment of a cell line (XTC-2) from the South African clawed toad, Xenopus laevis. Experientia. 1973;29:4667. DOIPubMedGoogle Scholar
  13. Gimenez  DF. Staining rickettsiae in yolk-sac cultures. Stain Technol. 1964;39:13540.PubMedGoogle Scholar
  14. Teysseire  N, Chiche-Portiche  C, Raoult  D. Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Res Microbiol. 1992;143:8219. DOIPubMedGoogle Scholar
  15. Eremeeva  ME, Balayeva  NM, Ignatovich  VF, Raoult  D. Proteinic and genomic identification of spotted fever group rickettsiae isolated in the former USSR. J Clin Microbiol. 1993;31:262533.PubMedGoogle Scholar
  16. Teysseire  N, Raoult  D. Comparison of Western immunoblotting and microimmunofluorescence for diagnosis of Mediterranean spotted fever. J Clin Microbiol. 1992;30:45560.PubMedGoogle Scholar
  17. Laemmli  UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:6805. DOIPubMedGoogle Scholar
  18. Roux  V, Fournier  PE, Raoult  D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:205865.PubMedGoogle Scholar
  19. Roux  V. Phylogenetic analysis and taxonomic relationships among the genus Rickettsia. In: Raoult D, Brouqui P, editors. Rickettsiae and rickettsial diseases at the turn of the third millennium. Marseille: Elsevier;1999. p. 52-66.
  20. Dessen  P, Fondrat  C, Valencien  C, Munier  G. BISANCE: a French service for access to biomolecular databases. Cabios. 1990;6:3556.PubMedGoogle Scholar
  21. Felsenstein  J. PHYLIP-phylogeny inference package (version 3.2). Cladistics. 1989;5:1646.
  22. Jukes  TH, Cantor  CR. Mammalian protein metabolism. In: Munro HN, editors. Evolution of protein molecules. New York: Academic Press; 1969. p. 121-32.
  23. Saitou  N, Nei  M. The neighbor-joining method: a new method for sequences. J Mol Biol. 1987;16:11120.
  24. Brown  JKM. Bootstrap hypothesis tests for evolutionary trees and other dendograms. Proc Natl Acad Sci U S A. 1994;91:122937. DOIPubMedGoogle Scholar
  25. Maurin  M, Birtles  RJ, Raoult  D. Current knowledge of Bartonella species. Eur J Clin Microbiol Infect Dis. 1997;16:487506. DOIPubMedGoogle Scholar
  26. Perry  RD, Fetherston  JD. Yersinia pestis: etiologic agent of plague. Clin Microbiol Rev. 1997;10:3566.PubMedGoogle Scholar
  27. Weiss  E, Moulder  JW. The Rickettsias and Chlamydias. In: Kreig NR, Holt JG, editors. Bergey's manual of systematic bacteriology. Baltimore: Williams & Wilkins; 1984; p. 687-739.
  28. Watret  GE, Pringle  CR, Elliott  RM. Synthesis of Bunyavirus-specific proteins in a continuous cell line (XTC-2) derived from Xenopus laevis. J Gen Virol. 1985;66:47382. DOIPubMedGoogle Scholar
  29. O'Neill  SL, Pettigrew  MM, Sinkins  SP, Braig  HR, Andreadis  TG, Tesh  RB. In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line. Insect Mol Biol. 1997;6:339. DOIPubMedGoogle Scholar
  30. Bouyer  DH, Crocquet-Valdes  PA, Walker  DH. Expression and size determination of the rOmpa protein of Rickettsia felis. Proceedings of the 15th meeting of the American Society for Rickettsiology. Florida: ASR; 2000. p. 61.
  31. Roux  V, Rydkina  E, Eremeeva  M, Raoult  D. Citrate synthase gene comparison: a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol. 1997;47:25261. DOIPubMedGoogle Scholar

Main Article

Page created: March 16, 2011
Page updated: March 16, 2011
Page reviewed: March 16, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external