Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 8, Number 8—August 2002
Research

Genetic Characterization of Hantaviruses Transmitted by the Korean Field Mouse (Apodemus peninsulae), Far East Russia

Kumari Lokugamage*, Hiroaki Kariwa*Comments to Author , Daisuke Hayasaka*, Bai Zhong Cui*, Takuya Iwasaki†, Nandadeva Lokugamage*, Leonid I. Ivanov‡, Vladimir I. Volkov‡, Vladimir A. Demenev§, Raisa Slonova¶, Galina Kompanets¶, Tatyana Kushnaryova¶, Takeshi Kurata†, Kenji Maeda*, Koichi Araki*, Tetsuya Mizutani*, Kumiko Yoshimatsu#, Jiro Arikawa#, and Ikuo Takashima*
Author affiliations: *Hokkaido University, Sapporo, Japan; †National Institute of Infectious Diseases, Tokyo, Japan; ‡Plague Control Station, Khabarovsk, Russia; §Far Eastern Medical Association, Khabarovsk, Russia; ¶Russian Academy of Medical Sciences, Vladivostok, Russia; #Hokkaido University School of Medicine, Sapporo, Japan;

Main Article

Table 1

Primers used for reverse transcription-polymerase chain reaction and/or sequencing of S and M genome segments of hantaviruses

Gene Primer name Primer sequence (5´–3´) Position
S segment M13 Fw ctggccgtcgttttac
PEN 215 S Fw gaattgaaagacaattggc 215–233
KPS3a tc(a/c)agcatgaaggc(a/t)gaagagat 592–703
PEN 780 SFw acagaggcaggcagctttag 780–799
PEN 1042 S Fw gcaggatatgcggaatacaa 1042–1061
HTNV 1390 S Fw attgcactattattatcagg 1390–1409
HTNV Full S ttctgcagtagtagtag(t)a(g)ctccctaa
PEN180 S Rv ttccctgtctgttaatgctc 180–199
PEN 585 S Rv tgggcaaggacacatagaga 585–604
PEN 946 Rv atgatggtgactcgatgtct 946–965
PEN 1160 S Rv gttgtattcccattgactgt 1160–1179
HTNV 1493 SRv cacccacaacggattaactg 1493–1512
M13 Rv caggaaacagctatgac
M segment HS1a ac(a/c)tgtca(c/a)tttgg(a/t)gaccc 2636–2655
HS2a tcaca(g/a)gcctttattga(g/t)gt 3072–3091
HS3a t(t/c)aggaa(ga)aaatg(tc)aactttgc 2715–2736
HS4a acacc(a/t)gaaccccaggc(a/c)cc 3000–3019
M13 Fw ctggccgtcgttttac
M13 Rv caggaaacagctatgac

aPrimers designed by Yashina et al.

Main Article

Page created: July 16, 2010
Page updated: July 16, 2010
Page reviewed: July 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external