Volume 8, Number 8—August 2002
Research
Genetic Characterization of Hantaviruses Transmitted by the Korean Field Mouse (Apodemus peninsulae), Far East Russia
Table 1
Gene | Primer name | Primer sequence (5´–3´) | Position |
---|---|---|---|
S segment | M13 Fw | ctggccgtcgttttac | |
PEN 215 S Fw | gaattgaaagacaattggc | 215–233 | |
KPS3a | tc(a/c)agcatgaaggc(a/t)gaagagat | 592–703 | |
PEN 780 SFw | acagaggcaggcagctttag | 780–799 | |
PEN 1042 S Fw | gcaggatatgcggaatacaa | 1042–1061 | |
HTNV 1390 S Fw | attgcactattattatcagg | 1390–1409 | |
HTNV Full S | ttctgcagtagtagtag(t)a(g)ctccctaa | ||
PEN180 S Rv | ttccctgtctgttaatgctc | 180–199 | |
PEN 585 S Rv | tgggcaaggacacatagaga | 585–604 | |
PEN 946 Rv | atgatggtgactcgatgtct | 946–965 | |
PEN 1160 S Rv | gttgtattcccattgactgt | 1160–1179 | |
HTNV 1493 SRv | cacccacaacggattaactg | 1493–1512 | |
M13 Rv | caggaaacagctatgac | ||
M segment | HS1a | ac(a/c)tgtca(c/a)tttgg(a/t)gaccc | 2636–2655 |
HS2a | tcaca(g/a)gcctttattga(g/t)gt | 3072–3091 | |
HS3a | t(t/c)aggaa(ga)aaatg(tc)aactttgc | 2715–2736 | |
HS4a | acacc(a/t)gaaccccaggc(a/c)cc | 3000–3019 | |
M13 Fw | ctggccgtcgttttac | ||
M13 Rv | caggaaacagctatgac |
aPrimers designed by Yashina et al.
Page created: July 16, 2010
Page updated: July 16, 2010
Page reviewed: July 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.