Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 10, Number 4—April 2004

Research

Influenza A Virus PB1-F2 Gene in Recent Taiwanese Isolates

Guang-Wu Chen*, Ching-Chun Yang†, Kuo-Chien Tsao†‡, Chung-Guei Huang†‡, Li-Ang Lee†‡, Wen-Zhi Yang§, Ya-Ling Huang†‡, Tzou-Yien Lin¶, and Shin-Ru Shih†‡Comments to Author 
Author affiliations: *National Health Research Institutes, Taipei, Taiwan; †Chang Gung University, Tao-Yuan, Taiwan; ‡Chang Gung Memorial Hospital, Tao-Yuan, Taiwan; §Center for Disease Control and Prevention, Taipei, Taiwan; ¶Chang Gung Children’s Hospital, Tao-Yuan, Taiwan

Main Article

Table

Primers used for reverse transcription–polymerase chain reaction

Primer/nt position Sequence Size (bp)
H1F-78a
GATGCAGACACAATATGTATAGG
611
H1R-689a
CICTACAGAGACATAAGCATTT

H3F-114b
TCAGATTGAAGTGACTAATGCT
976
H3R-1120b
AATTTTGATGCCTGAAACCGT

PB1F-32c
TCAATCCGACCTTACTTTTC
409
PB1R-441c AGCAGGCTGGTTTCTATTTA

aGenomic position based on A/Puerto Rico/8/34(H1N1) nc002017.
bGenomic position based on A/Hong Kong/1/68(H3N2) af348176.
cGenomic position based on A/Puerto Rico/8/34(H1N1) isdn13420.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO