Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 10, Number 7—July 2004

Dispatch

Emergence of Multidrug-resistant Salmonella Paratyphi B dT+, Canada

Michael R. Mulvey*Comments to Author , David Boyd*, Axel Cloeckaert†, Rafiq Ahmed*, Lai-King Ng, and the Provincial Public Health Laboratories1
Author affiliations: *Health Canada, Winnipeg, Manitoba, Canada; †Institut National de la Recherche Agronomique, Nouzilly, France

Main Article

Table

PCR primer to detect various regions of SGI1

Set Primer Primer sequence
(5′ to 3′) Coordinatesa Product size (bp)
St1
U9-L1
P1-R1
TACTACAAGCAGATAACGCC
TAGAAACGACAAAGCGCGTG
2771–2790
3660–3679
909
St3
P134-L1
P134-R2
AATCGACACGCGCTGTATTG
CTTCCCATAATGCCGCAATG
16350–16369
17287–17306
957
St4
P134-L1
P134-R1
TGACCCAATTCCAAAGCCAC
GTGTTTGGGCAAGATCCCAG
16784–16803
17820–17839
1490
St5
St2-GP21
St2-GP6
ATAACGGCAGGTTCCGGTTC
CGATGAAGCGCACAAATTTG
20173–20192
21089–21108
936
St6 St2-GP24
St2-GP28 TCAAGATTCCTATCTGCAGG
AGAGTTACTAGACCAAGCGC 24363–24382
25182–25201 838

aCoordinates from accession no. AF261825.

Main Article

1Provincial Public Health Laboratory Members: Lewis Abbott (Prince Edward Island), Kevin Forward (Nova Scotia), Glenna Hardy (New Brunswick), Greg Horsman (Saskatchewan), Judy Isaac-Renton (British Columbia), Frances Jamieson (Ontario), Jean Joly (Quebec), Jutta K. Preiksaitis (Alberta), Sam Ratnam (Newfoundland), Paul Van Caeseele (Manitoba).

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO