Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 2—February 2005

Research

Spotted Fever Group and Typhus Group Rickettsioses in Humans, South Korea

Yeon-Joo Choi*1, Won-Jong Jang1*, Jong-Hyun Kim*, Ji-Sun Ryu*, Seung-Hyun Lee*, Kyung-Hee Park*, Hyung-Suk Paik†, Young-Sang Koh‡, Myung-Sik Choi§, and Ik-Sang Kim§Comments to Author 

Author affiliations: *Konkuk University, Choongbuk, Republic of Korea; †Pusan National University, Pusan, Republic of Korea; ‡Cheju National University College of Medicine, Jeju, Republic of Korea; §Seoul National University College of Medicine and Institute of Endemic Disease, Seoul, Republic of Korea

Main Article

Table 1

Oligonucleotide primers for amplification of partial rickettsial genes*

Primer Target rickettsia group Gene Position Nucleotide sequence (5′–3′)
rompB OF SFG and TG rompB† 3,620–3,643 GTAACCGGAAGTAATCGTTTCGTAA
rompB OR SFG and TG rompB 4,131–4,109 GCTTTATAACCAGCTAAACCACC
rompB SFG IF SFG rompB 3,652–3,674 GTTTAATACGTGCTGCTAACCAA
rompB SFG/TG IR SFG and TG rompB 4,077–4,057 GGTTTGGCCCATATACCATAAG
rompB TG IF TG rompB 3,828–3,850 AAGATCCTTCTGATGTTGCAACA
RpCS.877p§ SFG and TG gltA‡ 877–895 GGGGGCCTGCTCACGGCGG
RpCS.1,258n§ SFG and TG gltA 1,258–1,237 ATTGCAAAAAGTACAGTGAACA
RpCS.896p SFG and TG gltA 896–915 GGCTAATGAAGCAGTGATAA
RpCS.1,233n SFG and TG gltA 1,233–1,215 GCGACGGTATACCCATAGC

*SFG, spotted fever group; TG, typhus group; OR, outer reverse primer; OF, outer forward primer.
†Oligonucleotide primer sequences derived from Rickettsia conorii genes (accession no. AF123721).
‡Oligonucleotide primer sequences derived from R. prowazekii genes (accession no. M17149).
§Primer sequences derived from (9).

Main Article

1Y.-J. Choi and W.-J. Jang contributed equally to this work.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO