Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 10—October 2007

Dispatch

Foot-and-Mouth Disease Virus Serotype A in Egypt

Nick J. Knowles*Comments to Author , Jemma Wadsworth*, Scott M. Reid*, Katherine G. Swabey*, Alaa A. El-Kholy†, Adel Omar Abd El-Rahman†, Hatem M. Soliman†, Katja Ebert*, Nigel P. Ferris*, Geoffrey H. Hutchings*, Robert J. Statham*, Donald P. King*, and David J. Paton*
Author affiliations: *Institute for Animal Health, Surrey, United Kingdom; †Veterinary Sera and Vaccines Research Institute, Cairo, Egypt;

Main Article

Table 2

Oligonucleotide primers used for RT-PCR and sequencing*

Primer name Primer sequence (5′→3′) Sense Gene Position†
A-1C562F TACCAAATTACACACGGGAA Forward VP3 3123–3142
A-1C612F TAGCGCCGGCAAAGACTTTGA Forward VP3 3173–3193
EUR-2B52R GACATGTCCTCCTGCATCTGGTTGAT Reverse 2B 3963–3988
NK72 GAAGGGCCCAGGGTTGGACTC Reverse 2A/2B 3897–3917
A-1D523R CGTTTCATRCGCACRAGRA Reverse VP1 3748–3766

*RT-PCR, reverse transcription–PCR.
†Position on the genome of A21/Lumbwa/KEN/64 (GenBank accession no. AY593761).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO