Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 11—November 2007

Research

Canonical Insertion-Deletion Markers for Rapid DNA Typing of Francisella tularensis

Pär Larsson*†, Kerstin Svensson*†, Linda Karlsson*, Dimitri Guala*, Malin Granberg*, Mats Forsman*, and Anders Johansson*†Comments to Author 
Author affiliations: *Swedish Defence Research Agency, Umeå, Sweden; †Umeå University, Umeå, Sweden;

Main Article

Table

Insertion-deletion loci, genomic locations, and primers

Ftind locus* Positions† Pattern Forward primer sequence (5′→3′)‡ Reverse primer sequence (5′→3′)
1 1152573–1152844 12222 TCTCGTGACAGAGCTTTACAA GGGAGAATTGATTATGGCTTAC
2 895732–896067 12222 AGCAGCGTATCGAAGAGATAG TAAATCTAGTTGGCTGAGTAATAAAGTC
3 769704–770059 12222 CAAACCTAATTGCTCCAGAAC GCAGCATATCTTTGGTCATCTAT
4 520340–520556 12222 TTTGAAAAGCTAGAAAAAGATGC ACCAAGAATATTAAAAGCCAAATC
5 1628363–1628558 12222 AACTAAGTTGTTTTAGTGGGTTCC CAATTTTATACCCCAGTTAATATTTGA
6 562346–562675 12222 CAACAATCTCACCATTACCTAAAA GCTAGGCAAGCCATTATATTTATC
7 688418–688771 12222 CCAAAATATACCAAAATATCCTATCA ATTTATGCAATATCACAAGTTCCA
8 198167–198521 12222 GTGACCTAATCAAAGAGCAACTAA ATCTGCATACTTGAGTAAATGCTT
9 1830520–1830768 11211 CTCAAGAAATTAAAGGGATGAGTT ATTTGCTCAGTACCTGCTAATGTA
10 1113820–1114081 11211 CATTCCTAGTRATAGCTCCTGCT ATTAAGCTTCAACACTATCATCATCT
11 1238526–1238784 11211 TACTTTTAATGCTTCAGCGACA AATCACCAATAACCCAGACAAC
12 725006–725258 11211 GCCTATGCTGGTAAAGTTGG TCACCAATAGCTTCCATAACAC
13 1490938–1491179 12211 AACTCCTGGTTTCCCACAC GCTACAAAACTCACTATGTTCAGAC
14 625186–625399 12211 GACTGAACAACAACTGGATTATCAC TGTAGTCCATTAGGGCAGTAATCTT
15 573074–573303 12111 GGTTTTGTTGCTAAATCTGC ACGCTGATCATCAATCATTC
16 1628145–1628393 12111 TCCTTTAAAGAAACGGCATA TCTGTACGGAACCCACTAAA
17 239966–240157 12111 CATGAAAACTTGGTTATAGCTGA GCGCAAGATCAGCTTAGTT
18 439229–439434 12111 AGAGTTAACCCATTCAACAAGA GGCAAGGTTTCTGGATAGAC
19 408363–408515 12111 TTTGATAGCTCAAATGCAAGA AGCTAGCTTGCCTCTTTTCT
20 602863–603177 11122 AAATCATTTAACAATTGGTATCTTT TAGCTCTGAGTTAGAAAAACTCG
21 271531–271863 11122 TCTTCTTGTATAAGATGCGCTAAA GGTTAAGTTAGGGCAATGTAAGAT
22 5648–5976 11122 TGACAAAGAAGACTAAGCACAAAT GGTTTGATAAATGCAAACTATATGAT
23 1062332–1062553 11122 TCAACCGGCTTTATGAGAGTA TATTACGAGACCGAAAATACGATA
24 1641399–1641720 11122 AATTCAAAAAGCGATAAGTAACCT GCCAGCAACATACTCTTTTGT
25 267938–268267 11122 AAATTAAAGCAAGGACAGGTTTAT TCCATAGTTATTTCAACTTGGTTT
26 1828819–1829145 11122 AGCTGCTAAATCTAAACTCTTTGC GCTCCCTCAACTAGATCTATCATC
27 960872–961191 11122 AATCGCATACATTTCTGCTGTA GCTTTTCCAAATGAGGATATTAAA
28 1136267–1136582 11122 AAAAGTAGCTGCAGAAGTATACCC TTCTCAAAATGTAAACATGCTTCT
29 1190422–1190738 11122 CTTGAGCTTACGCCCTTTTAT ATGTCCGCAATATTGTCCTAAC
30 871284–871614 11112 CTGCATTTTCAACATTACTCAGAT ATTCATAAAGATCATCCATTCCTC
31 518787–519092 11112 AGCTGTAGTGATATAAAGAAAAGTTACAT CTATTTCGTAGCGAGTAAGAATTT
32 1709427–1709741 11112 TTATGCAAATAACTATCCAAGTGTT TTACCATTAGCTTCAAAAGTCTGT
33 511958–512251 11112 TACAAGCGTACCATCTAAGTCA CATATTGGGATGTCAAGCA
34 99015–99303 11112 TTGATATAACCAACATAAACACTGC TGAGTATAGAAATACAAAGCTACGC
35 772225–772590 11121 TGTGTAGTAACCCAGGAACTTTAT AATTTGATGCCATATGAGAGAAT
36 282847–283070 11121 TTTGGTATGAGTATTCTGGTCCTA GTATTTTGGTTTAGCTTACGGATT
37 1486225–1486603 11121 AATATTTGCAACCAATGATGATAC CAGTATCTTTGATGTTAGGGACAA
38 95621–95874 11121 GCTACGACAGGTCTATCTTTCTC CAACTTATGATTGGTGATGATGT

*Ftind, F. tularensis insertion-deletion marker.
†Location of the DNA amplified by PCR in the chromosome of Francisella tularensis strain SCHU S4.
‡Sequences given for forward primers represent the target-specific parts of the primers used. For inexpensive fluorescent labeling, each forward primer was synthesized with a 19-bp extension at the 5’-end, corresponding to an M13 sequence (5′-GTAAAACGACGGCCAGT-3′).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO