Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 8—August 2007

Dispatch

Babesia sp. EU1 from Roe Deer and Transmission within Ixodes ricinus

Sarah Bonnet*Comments to Author , Maggy Jouglin*, Monique L’Hostis†, and Alain Chauvin†
Author affiliations: *Institut National de la Recherche Agronomique, Nantes, France; †Ecole Nationale Vétérinaire de Nantes, Nantes, France;

Main Article

Table 1

Nucleotide sequences of PCR primers used for amplification and sequencing of 18S rRNA genes of Babesia spp.*

Primer Specificity Sequence (5′→3′) Annealing temperature, °C Fragment size, bp Reference
BAB Babesia/Theileria spp. 60 359 (11)
GF2 GYYTTGTAATTGGAATGATGG
GR2 CCAAAGACTTTGATTTCTCTC
EU1 Babesia sp. EU1 63 362 (8)
Up GTTTCTGMCCCATCAGCTTGAC
Down AGACAAGAGTCAATAACTCGATAAC
CRYPTO Apicomplexa 65 1,727 (4)
F AACCTGGTTGATCCTGCCAGTAGTCAT
R GAATGATCCTTCCGCAGGTTCACCTAC

*For parasites from tick samples, no sequence could be obtained with primer set CRYPTO because such primers likely hybridize to the Ixodes ricinus 18S rRNA gene and preferentially amplified this gene, probably because of its relative abundance.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO