Volume 14, Number 9—September 2008
Research
Circulation of 3 Lineages of a Novel Saffold Cardiovirus in Humans
Table 1
PCR oligonucleotides and formulations for cardiovirus screening*
| ID no. | Sequence (5′ → 3′) | Position† | Orientation | Usage |
|---|---|---|---|---|
| CF188 | CTAATCAGAGGAAAGTCAGCAT | 188–209 | + | Nested RT-PCR, 1st round‡ |
| CF204 | CAGCATTTTCCGGCCCAGGCTAA | 204–226 | + | Nested RT-PCR, 2nd round§ |
| CR718 | GCTATTGTGAGGTCGCTACAGCTGT | 718–742 | – | Nested RT-PCR, 2nd round§ |
| CR990 | GACCACTTGGTTTGGAGAAGCT | 990–1011 | – | Nested RT-PCR, 1st round‡ |
| CF723 | TGTAGCGACCTCACAGTAGCA | 723–743 | + | Real-time PCR¶ |
| CR888 | CAGGACATTCTTGGCTTCTCTA | 888–909 | – | Real-time PCR¶ |
| CP797 | FAM-AGATCCACTGCTGTGAGCGGTGCAA-BHQ1 | 797–821 | + (probe) | Real-time PCR¶ |
*ID, identification; RT-PCR, reverse transcription–PCR; FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1.
†Relative to Saffold virus EF165067 genome.
‡25-µL reactions used the QIAGEN OneStep RT-PCR kit (QIAGEN, Hilden, Germany), with 400 nmol/L each of 1st-round primers CF188 and CR990, 1 µL enzyme mix, 1 µg bovine serum albumin, and 5 µL RNA extract. Amplification involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C with a final elongation step of 5 min at 72°C.
§50-µL reactions used 1 µL of 1st-round PCR product, with 1x Platinum Taq buffer (Invitrogen, Karlsruhe, Germany), 200 µmol/L deoxynucleoside triphosphates each, 2.5 mmol/L MgCl2, 400 nmol/L each of 2nd-round primers CF204 and CR718, and 1 U Platinum Taq polymerase. Amplification involved 3 min at 94°C and 45 cycles of 20 s at 94°C, 30 s at 60°C, and 40 s at 72°C.
¶25-µL reactions used 3 µL of RNA extract, 1x reaction buffer and enzymes from the QIAGEN OneStep RT-PCR kit, 600 nM of primer CF723, 400 nM of primer CR888, and 160 nM of probe CP797. Cycling in an Applied Biosystems 7700 SDS instrument involved the following steps: 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s/58°C for 30 s.


