Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 1—January 2009

Dispatch

Hepatitis E Virus Genotype 3 Diversity, France

Florence Legrand-Abravanel, Jean-Michel Mansuy, Martine Dubois, Nassim Kamar, Jean-Marie Peron, Lionel Rostaing, and Jacques IzopetComments to Author 
Author affiliations: Institut National de la Santé et de la Recherche Médicale, Toulouse, France (F. Legrand-Abravanel, M. Dubois, L. Rostaing, J. Izopet); Centre Hospitalier Universitaire, Toulouse (F. Legrand-Abravanel, J.-M. Mansuy, M. Dubois, N. Kamar, J.-M. Peron, L. Rostaing, J. Izopet)

Main Article

Table 1

Primers used to amplify the whole hepatitis E virus genotype 3f genome

Fragment size, bp Nucleotide position* Sense primers (5′ → 3′) Antisense primers (5′ → 3′)
990 1–990 TAGGCAGACCACGTATGTGGTCGATGCCATGGA gccggtcccagatRtgSaccggRa
1,294 878–2172 ACAGAGGTGTATGTTAGATCCATATTTGGC GGGGAGAAGTCGCTAGAGAAACCTGATGT
2568 2001–4569 CCCAGCGSCWTTCGCTGACCGG CGGATAAGCCACTGGGGCATGCCRCACT
736 4542–5278 AGTGYGGCATGCCCCAGTGGCTTATCCG GCCGGTGGCGCGGGCAGCATAGGCA
1,480 5003–6484 ACGAATGTYGCGCAGGTYTGTGT cccttrtcctgctgngcattctcgacaga
964 6363–7327 GACAGAATTRATTTCGTCGGC TTTCCMGGGRGCGCGGAACCCCGAA

*Nucleotide position refers to Burma strain, M73218.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO