Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 10—October 2009

Dispatch

Escherichia coli as Reservoir for Macrolide Resistance Genes

Minh Chau Phuc Nguyen, Paul-Louis Woerther, Mathilde Bouvet, Antoine Andremont, Roland LeclercqComments to Author , and Annie Canu
Author affiliations: Université de Caen, Caen, France (M.C.P. Nguyen, M. Bouvet, R. Leclercq, A. Canu); University Paris-Diderot Medical School, Paris, France (P.-L. Woerther, A. Andremont)

Main Article

Table 2

Oligonucleotide primers used for detection of Escherichia coli macrolide resistance genes

Target gene Primer Sequence, 5′ → 3′ Product size, bp Annealing temperature, oC
mph(A) mphAF GTGAGGAGGAGCTTCGCGAG 403 60

mphAR
TGCCGCAGGACTCGGAGGTC


mph(B) mphBF GATATTAAACAAGTAATCAGAATAG 494 58

mphBR
GCTCTTACTGCATCCATACG


erm(A) ermAF TCTAAAAAGCATGTAAAAGAAA 533 52

ermAR
CGATACTTTTTGTAGTCCTTC


erm(B) ermBF GAAAAAGTACTCAACCAAATA 639 45

ermBR
AATTTAAGTACCGTTACT


erm(C) ermCF TCAAAACATAATATAGATAAA 642 45

ermCR
GCTAATATTGTTTAAATCGTCAAT


ere(A) ereAF GCCGGTGCTCATGAACTTGAG 420 60

ereAR
CGACTCTATTCGATCAGAGGC


ere(B) ereBF TTGGAGATACCCAGATTGTAG 537 55

ereBR
GAGCCATAGCTTCAACGC


mef(A) mefAF AGTATCATTAATCACTAGTGC 345 54

mefAR
TTCTTCTGGTACTAAAAGTGG


msr(A) msrAF GCACTTATTGGGGGTAATGG 384 58
msrAR GTCTATAAGTGCTCTATCGTG

Main Article

TOP