Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 2—February 2009

Research

Identification of Melioidosis Outbreak by Multilocus Variable Number Tandem Repeat Analysis

Bart J. CurrieComments to Author , Asha Haslem, Talima Pearson, Heidie Hornstra, Benjamin Leadem, Mark Mayo, Daniel Gal, Linda Ward, Daniel Godoy, Brian G. Spratt, and Paul Keim
Author affiliations: Menzies School of Health Research, Darwin, Northern Territory, Australia (B.J. Currie, A. Haslem, M. Mayo, D. Gal, L. Ward); Northern Territory Clinical School, Darwin (B.J. Currie, L. Ward); Northern Arizona University, Flagstaff, Arizona, USA (T. Pearson, H. Hornstra, B. Leadem, P. Keim); Imperial College, London, UK (D. Godoy, B.G. Spratt)

Main Article

Table 1

Characteristics of 4 VNTR loci used for identification of Burkholderia pseudomallei*

Characteristic VNTR loci
2341 1788 933 389
Color-labeled forward primer sequence (5′ → 3′) FAMGGCTTCGCACCCGCCCCATTTCAGC PETGCGCGGCGAGAACGGCAAGAACGAA NEDATGGTGGCGGCCGTCGGCGAAAACC VICGTTACAAGCGCGGGTCGGCAAGAGGCTGAAA
Reverse primer sequence (5′ → 3′) GCACCGGGCGCGGCGCACTCG GAGCATCGGGTGGGCGGCGCGTATTGAT GCTCGAATGGGTGTACGAAGGGCCACGCTGATTC GCCGGTGTTGAACGAGTGGGTGGCGTAAGC
Repeat sequence (5′ → 3′) TTCGTGCGC GTCGTGCGATCCTGCT CGGCGAGGGAAA GACGAACC
Minimum size, bp† (no. repeats) 111 (2) 235 (4) 171 (3) 221 (1)
Maximum size, bp (no. repeats) 243 (17) 382 (13) 337 (17) 292 (10)
No. alleles 16 10 13 9
No. null alleles 2/65 STs

*VNTR, variable number tandem repeat; STs, sequence types.
†Error range in fragment sizing is ± 3 bp.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO