Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 3—March 2009

Research

Integron-mediated Multidrug Resistance in a Global Collection of Nontyphoidal Salmonella enterica Isolates

Mary G. Krauland, Jane W. Marsh, David L. Paterson, and Lee H. HarrisonComments to Author 
Author affiliations: University of Pittsburgh School of Medicine and Graduate School of Public Health, Pittsburgh, Pennsylvania, USA (M.G. Krauland, J.W. March, D.L. Paterson, L.H. Harrison); University of Queensland, Royal Brisbane and Women’s Hospital, Brisbane, Queensland, Australia (D.L. Paterson)

Main Article

Table 2

Primers used for PCR amplification of Salmonella enterica integrons

Primer Sequence (5′ → 3′) Target Reference
5’CS GGCATCCAAGCAGCAAGC 5′ conserved segment (17)
3’CS AAGCAGACTTGACCTGAT 3′ conserved segment (17)
int_F CGATGCGTGGAGACCGAAACCTT intI1 (18)
int_R GTAACGCGCTTGCTGCTTGGATGC intI1 (18)
invA_F ACACAGCTCGTTTACGACCTGAAT invA (16)
invA_R AGACGACTGGTACTGATCGATATT invA (16)
sul1_F GCGCGGCGTGGGCTACC sul1 This study
sul1_R CCGCAAGGCTCGCTGGAC sul1 This study
aadA1_R CGATGACGCCAACTACCTCTGATA aadA1internal primer This study
arr2_F ATTGTTGGCGTTGTTGAAGACTGG arr2 internal primer This study
cmlA5_F GAATGGGAATGGGATGCCTGATAG cmlA5 internal primer This study
oxa10_R TTTACAAAGCACGAAGACACCATT blaOXA10 internal primer This study
cmlA_F GCAGGTCGCGAGGAAAGTAATG cmlA 5′ forward primer This study
cmlA_R ACACCGCCCAAGCAGAAGTAGA cmlA 3′ reverse primer This study
blaOXA30_F TCGCAAGAAATAACCCAAAAA blaOXA30 internal primer This study
aacA4_F AAGCGGGGTTTGAGAGG aacA4 forward primer This study
aacA4_R CGCGTACTCCTGGATCGGTTTCTT aacA4 reverse primer This study
dfr_1_F TTTAGGCCAGTTTTTACCCAAGAC dfrA1 internal primer This study
ere_est_R GCGCCAGCAGAATTATCCTTACAT ereA2 internal primer This study
aac(6’)IIC_F CCGCGGGATTGACCAGT aac(6′)IIC internal primer This study
dfrA12_F GCTGCGCATTTTGGTTCC dfrA12 internal primer This study
aadA2_R TGTCATTGCGCTGCCATTCTCC aadA2 internal primer This study
qacH_F GCGTCGCCGTTCTAAATCTGCTAT qacH internal primer This study
aac_R GGGCGCCGGGTGTCTGGAG aacA4 internal primer This study
IS_F GTCACGCCCCGACCATCACCTTCC IS1247 internal primer This study
TNP_F CCGCGCTGGCCGACCTGAAC Transposase A internal primer This study
ere_F CCTAACCGGGCGATTCAA Erythromycin esterase internal primer This study
cmlA_R_internal ATCACACGCCCCATAAAACGAG cmlA internal primer This study
arr_R2 GCGGGATCCAGAACCAGGCGACAT arr-2 internal primer This study
arr_accA_R AGAGCGGCTTTGGTTCC Internal primer arr-2–accA junction This study
ere_F2 CGCTGATTTCGCTGTCCTGA ereA internal primer This study
dfrA17_F AAAAAGGCTAACAAGTCGT dfrA17 internal primer This study
cml_R2 GCTGAATTGTGCTCGCTGTCGTA cml internal primer This study
aadA_con_F CGACATCATYCCGTGGCGTTAT aadA forward consensus primer This study
aadA_con_R CGGCAGCCACATCCTTC aadA reverse consensus primer This study
aacA4_F ATGACCTTGCGATGCTCT aacA4 internal primer This study
aacA4_R CTCGATGGAAGGGTTAGG aacA4 internal primer This study
blaOXA30_F ACACAATACATATCAACTTCGC blaOXA30-aadA internal primer This study
aadA1_R_S GGATAACGCCACGGAATGATGTC aadA1 internal primer This study
albany_PSE1a_F CCTTTGGGGCCACCTACAG blaPSE1 primer This study
albany_PSE1b_F ATCAAAATTATGGGGTTACTTACA blaPSE1 primer This study
albany_dfr1_F ATGGTAGCTATATCGAAGAATGGA dfr primer This study
albany_dfr2_F AAGTACTGGCTATTGCCTTAGGAG dfr primer This study
U7-L12 ACACCTTGAGCAGGGCAAAG SGI1 left junction (15)
LJ-R1 AGTTCTAAAGGTTCGTAGTCG SGI1 left junction (15)
104-RJ TGACGAGCTGAAGCGAATTG SGI1 right junction (15)
104-D ACCAGGGCAAAACTACACAG SGI1 right junction (15)

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO