Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 4—April 2009

Research

Hantavirus Pulmonary Syndrome, Central Plateau, Southeastern, and Southern Brazil

Luiz T.M. FigueiredoComments to Author , Marcos L. Moreli, Ricardo L.M. de Sousa, Alessandra A. Borges, Glauciane G. de Figueiredo, Alex M. Machado, Ivani Bisordi, Teresa K. Nagasse-Sugahara, Akemi Suzuki, Luiz E. Pereira, Renato P. de Souza, Luiza T.M. de Souza, Carla T. Braconi, Charlotte M. Harsi, Paolo M. de Andrade Zanotto, and the Viral Diversity Genetic Network Consortium
Author affiliations: University of São Paulo School of Medicine, Ribeirão Preto, Brazil (L.T.M. Figueiredo, M.L. Moreli, R.L.M. de Sousa, A.A. Borges, G.G. de Figueiredo, A.M. Machado); Adolfo Lutz Institute, São Paulo, Brazil (I. Bisordi, T.K. Nagasse-Sugahara, A. Suzuki, L.E. Pereira, R.P. de Souza, L.T.M. de Souza); University of São Paulo, São Paulo (C.T. Braconi, C.M. Harsi, P.M. de Andrade Zanotto)

Main Article

Table 1

Primers used for reverse transcription–PCR of hantaviruses, Brazil, 1998–2007

Gene*/primer Sequence (5′ → 3′) Nucleotide annealing site
N/SAHN-C CAAAACCAGTTGATCAACAGGG 213–236 of hantavirus small RNA segment
N/SAHN-S GATGAATCATCCTTGAACCTTAT 454–477 of hantavirus small RNA segment
G1/HANGn-C GGGCAGTAAGTGCTGAAAC 1301–1320 of hantavirus medium RNA segment
G1/HANGn-S ACATTTAGCAGTTTGCCATGGG 1602–1625 of hantavirus medium RNA segment

*N, nucleocapsid; G1, glycoprotein 1.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO