Volume 18, Number 4—April 2012
Dispatch
Cosavirus Infection in Persons with and without Gastroenteritis, Brazil
Table 2
Oligonucleotides used for detection and quantification of cosaviruses*
| Oligonucleotide identity | Sequence, 5′ → 3′ | Genomic target region, RT-PCR type | Use | Reference |
|---|---|---|---|---|
| DKV-N5U-F1 | CGTGCTTTACACGGTTTTTGA (+) | 5’-UTR, nested RT-PCR 1st round | Cosavirus detection† | (3) |
| DKV-N5U-R2 | GGTACCTTCAGGACATCTTTGG (–) | |||
| DKV-N5U-F2 | ACGGTTTTTGAACCCCACAC (+) | 5’-UTR, nested RT-PCR 2nd round | ||
| DKV-N5U-R3 | GTCCTTTCGGACAGGGCTTT (–) | |||
| HCosV-rtF735-1 | TTGTAGYGATGCTGTRTGTGTGTG (+) | 5’-UTR, real time RT-PCR | Brazilian cosavirus quantification† | This study |
| HCosV-rtP783 | FAM-AGCCTCACAGGCCRRAAGCCCTGTC-DDQ1 (+, Probe) | |||
| HCosV-rtR827-1 | CCAYTGTGTGGGTCCTTTCG (–) |
*RT-PCR, reverse transcription PCR; UTR, untranslated region; FAM, fluorescein; R, G/A; DDQ1, deep dark quencher 1; Y, C/T.
†RT-PCR reactions were carried out using the QIAGEN One-step RT-PCR kit as described by the manufacturer (QIAGEN, São Paulo, Brazil), 300 nmol/L of each primer, 200 nmol/L of the probe (real time RT-PCR assay), 1 μg bovine serum albumin, and 5 μL RNA extract. Second-round reactions used the Platinum Taq DNA Polymerase Kit as described by the manufacturer (Invitrogen, São Paulo, Brazil) with 2.5 mol/L MgCl and 1 µL of first-round PCR product. Real time RT-PCR amplification involved 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s and 58°C for 30 s (fluorescence measured).Nested RT-PCR involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C; and a final elongation step of 5 min at 72°C. Second-round reactions used 3 min at 94°C and thermal cycling as for the first round.
1These authors contributed equally to this article.


