Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 4—April 2012

Dispatch

Cosavirus Infection in Persons with and without Gastroenteritis, Brazil

Andreas Stöcker1, Breno Frederico de Carvalho Dominguez Souza1, Tereza Cristina Medrado Ribeiro1, Eduardo Martins Netto, Luciana Oliveira Araujo, Jefferson Ivan Corrêa, Patrícia Silva Almeida, Angela Peixoto de Mattos, Hugo da Costa Ribeiro, Diana Brasil Pedral-Sampaio, Christian Drosten, and Jan Felix DrexlerComments to Author 
Author affiliations: University of Bonn Medical Centre, Bonn, Germany (A. Stöcker, C. Drosten, J.F. Drexler); Federal University of Bahia, Salvador, Brazil (A. Stocker, B.F.C.D. Souza, T.C.M. Ribeiro, E.M. Netto, L.O. Araujo, J.I. Corrêa, P.S. Almeida, A.P. de Mattos, H.C. Ribeiro Jr, D.B. Pedral Sampaio)

Main Article

Table 2

Oligonucleotides used for detection and quantification of cosaviruses*

Oligonucleotide identity Sequence, 5′ → 3′ Genomic target region, RT-PCR type Use Reference
DKV-N5U-F1 CGTGCTTTACACGGTTTTTGA (+) 5’-UTR, nested RT-PCR 1st round Cosavirus detection† (3)
DKV-N5U-R2 GGTACCTTCAGGACATCTTTGG (–)
DKV-N5U-F2 ACGGTTTTTGAACCCCACAC (+) 5’-UTR, nested RT-PCR 2nd round
DKV-N5U-R3 GTCCTTTCGGACAGGGCTTT (–)
HCosV-rtF735-1 TTGTAGYGATGCTGTRTGTGTGTG (+) 5’-UTR, real time RT-PCR Brazilian cosavirus quantification† This study
HCosV-rtP783 FAM-AGCCTCACAGGCCRRAAGCCCTGTC-DDQ1 (+, Probe)
HCosV-rtR827-1 CCAYTGTGTGGGTCCTTTCG (–)

*RT-PCR, reverse transcription PCR; UTR, untranslated region; FAM, fluorescein; R, G/A; DDQ1, deep dark quencher 1; Y, C/T.
†RT-PCR reactions were carried out using the QIAGEN One-step RT-PCR kit as described by the manufacturer (QIAGEN, São Paulo, Brazil), 300 nmol/L of each primer, 200 nmol/L of the probe (real time RT-PCR assay), 1 μg bovine serum albumin, and 5 μL RNA extract. Second-round reactions used the Platinum Taq DNA Polymerase Kit as described by the manufacturer (Invitrogen, São Paulo, Brazil) with 2.5 mol/L MgCl and 1 µL of first-round PCR product. Real time RT-PCR amplification involved 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s and 58°C for 30 s (fluorescence measured).Nested RT-PCR involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C; and a final elongation step of 5 min at 72°C. Second-round reactions used 3 min at 94°C and thermal cycling as for the first round.

Main Article

1These authors contributed equally to this article.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO