Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 24, Number 8—August 2018
Dispatch

Direct Detection of penA Gene Associated with Ceftriaxone-Resistant Neisseria gonorrhoeae FC428 Strain by Using PCR

David M. WhileyComments to Author , Lebogang Mhango, Amy V. Jennison, Graeme Nimmo, and Monica M. Lahra
Author affiliations: The University of Queensland, Brisbane, Queensland, Australia (D.M. Whiley, L. Mhango); Pathology Queensland Central Laboratory, Brisbane (D.M. Whiley, G. Nimmo); Queensland Health Forensic and Scientific Services, Archerfield, Queensland, Australia (A.V. Jennison); Griffith University, Gold Coast, Queensland, Australia (G. Nimmo); The Prince of Wales Hospital Randwich, Sydney, New South Wales, Australia (M.M Lahra); The University of New South Wales, Sydney (M.M. Lahra)

Main Article

Table 1

Primer and probe sequences for PCR to detect Neisseria gonorrhoeae FC428 strain*

Designation Oligonucleotide sequence, 5′ → 3′
Forward primer CGCAACCGTGCCGTT
Reverse primer GGGTATTGAATGTGTCTGTTGGA
Probe 1 Fam-TTCA+T+G+A+CA+G+AAC-Iowa Black FQ
Probe 2 Hex-TCA+T+G+G+CA+GA-Iowa Black FQ

*LNA bases are indicated by + preceding the base in the sequence.

Main Article

Page created: July 18, 2018
Page updated: July 18, 2018
Page reviewed: July 18, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external