Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 6, Number 2—April 2000

Research

Vibrio cholerae O139 in Calcutta, 1992-1998: Incidence, Antibiograms, and Genotypes

Arnab Basu*, Pallavi Garg*, Simanti Datta*, Soumen Chakraborty*, Tanuja Bhattacharya*, Asis Khan*, T. Ramamurthy*, S.K. Bhattacharya*, Shinji Yamasaki†, Yoshifumi Takeda‡, and G. Balakrish Nair*Comments to Author 
Author affiliations: *National Institute of Cholera and Enteric Diseases, Calcutta, India; †International Medical Center of Japan, Tokyo, Japan; and ‡National Institute of Infectious Diseases, Tokyo, Japan

Main Article

Table 1

Oligonucleotide primer sequences used in polymerase chain reaction assays of Vibrio cholerae O139

Amplicon
Gene Primer sequence (5'-3') size Ref.
ctxA CTCAGACGGGATTTGTTAGGCACG 301 14
TCTATCTCTGTAGCCCCTATTACG
tcpA GAAGAAGTTTGTAAAAGAAGAACAC 471 14
(El Tor) GAAGGACCTTCTTTCACGTTG
tcpA GATTGTGCGTCTTGCATTTAGG 2200 16
 (classical) GTGAATAAATCAGGTGTAATGTCG
ace GCTTATGATGGACACCCTTTA 284 15,a
TTTGCCCTGCGAGCGTTAAAC
zot CACTGTTGGTGAGCGTTATCG 243 a
CAAGCGCTGTGGGTAGAAGTGAAA

aThis study.

Main Article

TOP