Volume 6, Number 2—April 2000
Dispatch
Bacteroides fragilis Enterotoxin Gene Sequences in Patients with Inflammatory Bowel Disease
Table 1
Demographic characteristics of patients with inflammatory bowel disease (IBD)
| Patient characteristics | IBD (n = 83) | Diarrhea patients (n = 18) | Controls (n=69) |
|---|---|---|---|
| Sex | |||
| M | 38 | 4 | 40 |
| F | 45 | 14 | 29 |
| Age (yrs) | 10-80 | 20-75 | 40-72 |
| Mean = | 45.5 | 45.6 | 58.2 |
| Duration of disease (yrs) | |||
| UC | 1-13 (5.6) | 1-6 (2.6) | NA |
| CD | 1-20 (10.5) | ||
| Therapeutic treatment | |||
| 5-ASA | 58 | 0 | 0 |
| 5-ASA+Steroids | 35 | 0 | 0 |
| 6-MP/ | 20 | 0 | 0 |
| Azathioprine | |||
| MTX | 1 | 0 | 0 |
| Antibiotics | 1 | 1 | 0 |
| Antidiarrheals | 1 | 3 | 8 |
1A 100-mg sample of stool was suspended in 400 µl of TES buffer (50 mM Tris [pH 8], 5 mM EDTA, 50 mM NaCl) and centrifuged at 1,000 x g for 3 min to remove large particles. The supernatant was then centrifuged at 5,000 x g for 7 min. The pellet was washed once in 200 µl of TES, and centrifuged at 5,000 x g for 3 min, and the supernatant was discarded. The pellet was suspended in 100 µl of sterile H2O and boiled for 10 min, then centrifuged at 1,000 x g for 2 min and the supernatant containing the DNA extracted twice with phenol: chloroform: isoamyl alcohol (25:24:1) and precipitated with ethanol. The sequences of the primers and probes used and PCR conditions were as described (14). Amplification with the outer primers RS-3 (5' TGAAGTTAGTGCCCAGATGCAGG 3') and RS-4 (5' GCTCAGCGCCCAGTATA TGACC 3') yielded a 367-bp product. Amplification of this product with the inner primers RS-1 (5' TGCGGCGAACTCGGTTAATGC 3') and RS-2 (5'AGCTGGGTTGTAGACATCCCACTGG' 3') amplified a 290-bp product. The reaction mixtures were prepared in 1X PCR buffer (50 mM KCl, 20 mM Tris HCl, 2.5 mM MgCl2, 100 µg bovine serum albumin per ml [pH 8.4]) and contained per reaction 20 pmol of the respective primers, 0.1 mM concentrations each of 2'-deoxynucleoside 5'-triphosphate, 2 U of recombinant DNA polymerase (rTaq) (Perkin Elmer, Norwalk, CT), and 10 µl purified fecal DNA. The final reaction volume was adjusted to 100 µl with sterile deonized water. The PCR profile included a denaturing step at 95°C for 30 sec, followed by a 60°C annealing step for 30 sec, with extension at 72°C for 30 sec. The outer PCR was performed for 35 cycles in a thermal cycler (MJ Research). Amplification with the inner primers was done for 30 cycles. Negative controls included a blank containing all PCR reagents with no DNA. As control for amplifiable DNA in the stool specimens, primers targeting the 16S rRNA gene of enteric bacteria were used as described by Kato et al. (15).


