Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 7, Number 1—February 2001

Research

A Flea-Associated Rickettsia Pathogenic for Humans

Didier Raoult*Comments to Author , Bernard La Scola*, Maryse Enea*, Pierre-Edouard Fournier*, Véronique Roux*, Florence Fenollar*, Marcio A.M. Galvao†, and Xavier de Lamballerie*
Author affiliations: *Unité des Rickettsies, CNRS UPRESA 6020, France; †Ouro Preto Federal University, Brazil

Main Article

Table 1

Primers used for PCR amplification and sequencing of the ELB agent strain Marseille-URRWFXCal2

Gene position relative
Gene Primer Nucleotide sequence (5'-3')  to open reading frame Reference
17 kDa 
antigen 17kDFa GCTCTTGCAACTTCTATGTT 31-50 This manuscript
17KdRa CATTGTTCGTCAGGTTGGCG 464-445 This manuscript
Citrate
synthase CSFEL1a TGATTCAGAATTTGCCGAAT 21-40 17
CS890ra GCTTTAGCTACATATTTAGG 890-871 17
CS532ra GCCGCAATGTCTTATAAATATTCT 532-555 This manuscript
CS1273ra CATAACCAGTGTAAAGCTG 1273-1255 This manuscript
CS244rb CTTTAATATCATATCCTCGAT 244-224 17
Rp877Pb GGGGACCTGCTCACGGCGG 797-815 18
rOmpB 120-M59a CCGCAGGGTTGGTAACTGC M59-M41 This manuscript
120-807a CCTTTTAGATTACCGCCTAA 807-788 This manuscript
120-607a AATATCGGTGACGGTCAAGG 607-626 This manuscript
120-1497a CTATATCGCCGGTAATT 1497-1480 This manuscript
120F-1351a TTTAGGAAACGCTGGTTCTC 1351-1370 This manuscript
120F-2934a GCGTTAGTTGCGATAATACT 2934-2915 This manuscript
120-2788a AAACAATAATCAAGGTACTGT 2788-2808 This manuscript
120-3599a TACTTCCGGTTACAGCAAAGT 3599-3579 This manuscript
120F-3440a GTTAATGCAACAACTACGGG 3440-3459 This manuscript
120F-4341a GCATCGAAGAAGTAACGCTG 4341-4322 This manuscript
120-4232a GGTTTCTCATTCTCTCTATATGG 4232-4254 This manuscript
120-4879a TTAGAAGTTTACACGGACTTT 4879-4857 This manuscript
120F-1749b CTATTAGTGGTAATATTGGTAC 1749-1770 This manuscript
120F-2495b CATGGTCATTACCTGCATTACC 2495-2481 This manuscript
120-4489b GTCTTCTGACGAAAACTACAA 4489-4509 This manuscript
ROmpA 190-70a ATGGCGAATATTTCTCCAAAA 70-90 18
190-701a GTTCCGTTAATGGCAGCATCT 701-681 19

aPrimers used for both PCR amplification and sequencing of the ELB agent strain Marseille-URRWFXCal2.
bPrimers used only for sequencing.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO