Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 7, Number 6—December 2001

Dispatch

Community-Acquired Acinetobacter radioresistens Bacteremia in an HIV-Positive Patient

Paolo Visca*†Comments to Author , Andrea Petrucca‡, Patrizia De Mori†, Anna Festa†, Evangelo Boumis†, Andrea Antinori†, and Nicola Petrosillo†
Author affiliations: *Università di Roma Tre, Rome, Italy;; †Istituto Nazionale di Malattie Infettive "Lazzaro Spallanzani," Rome, Italy;; ‡Istituto Superiore di Sanità, Rome, Italy

Main Article

Table

Sequence motifs of the variable regions for Acinetobacter 16S rRNAs, encompassing positions 70-101 (helix 6) and 453-477 (helix 18)a

DNA group Helix 6 variable region Helix 18 variable region
1 GGAAGGUUGCUUCGGUAACUGACCUA GCUCUCUUAGUUAAUACCUAAGAUG
2 GGGAAGGUAGCUUGCUACCGGACCUA CCUACUUUAGUUAAUACCUAGAGAU
3 AGAGAGGUAGCUUGCUACUGAUCUUA GCUACUUUAGUUAAUACCUAGAGAU
4 GGAAGGGUACCUUGCUACCUAACCUA GCUACUCUAGUUAAUACCUAGAGAU
5 AGAUGAGGUGCUUGCACCUUAUCUUA GCUACUGAGACUAAUACUCUUGGAU
6 GGUGAUGUAGCUUGCUACAUUACCUA GCUACCUAGACUAAUACUCUAGGAU
7 GGAGAGGUAGCUUGCUACCUAACCUA GCUACUUGGAUUAAUACUCUAGGAU
8 GGAGAGGUAGCUUGCUACAUAACCUA GCUACCGAGAUUAAUACUCUUGGAU
9 GGAAGNGUAGCUUGCUACAUAACCUA GCUACCGAGAUUAAUACUCUUGGAU
10 GGGAGAUUGCUUCGCUAAUUGACCUA GCUCUUUUGGUUAAUACCCAAGAUG
11 GGGAGAUUGCUUCGGUAACUGACCUA CCUCUCUUGGUUAAUACCCAAGAUG
12 AUGAAGGUAGCUUGCUACUGGAUUCA GCUACCUAGAUUAAUACUUUAGGAU
AJ247210 AUGAAAGUAGCUUGCUACUGGAUUCA GCUACCUAGAUUAAUACUUUAGGAU
AR AUGAAAGUAGCUUGCUACUGGAUUCA GCUACCUAGAUUAAUACUUUAGGAU
TU13 GGGAAGGUAGCUUGCUACUGGACCUA GCUACUCUAGUUAAUACCUAGGGAU
TU14 GGAAGGGUAGCUUGCUACCUAACCUA CCUACCUAGAUUAAUACUCUAGGAU
TU15 GGAUAGGUUGCUUGCACUUGAUGCUA GCUUACCUGGUUAAUACCUGGGAUA
CTTU13 GGAGAGGUAGCUUGCUACUGAUCUUA GCUACUUUAGUUAAUACCUAGAGAU
1-3 GNUGAUGGUGCUUGCACUAUCACUUA GCUACUUUAGUUAAUACCUAGAGAU
BJ14 GGAAGGUUGCUUCGGUAUCUGACCUA GCUCUCUUAGUUAAUACCUAAGAUG
BJ15 AGUUAUGGUGCUUGCACUAUGACUUA GCUCUCUUAGUUAAUACCUAAGAUG
BJ16 AGUGAUGGUGCUUGCACUAUCACUUA GCUACUAGUACUAAUACUACUGGAU
BJ17
AGUGAUGGUGCUUGCACUAUCACUUA
GCUCUCCUAGUUAAUACCUAGGAUG

aRepresentative strains for each DNA group (1 to 12, TU13 to TU15, CTTU13, 1-3, BJ14 to BJ17) are those listed in ref. 2. The designations AJ247210 and AR refer to A. radioresistens LMG 10614 (genospecies 12) and to our isolate, respectively. Nucleotides in bold highlight the differences between members of genospecies 12.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO