Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 9, Number 5—May 2003

Research

Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster in Salmonella enterica Serovar Albany

Benoît Doublet*, Renaud Lailler†, Danièle Meunier*, Anne Brisabois†, David Boyd‡, Michael R. Mulvey‡, Elisabeth Chaslus-Dancla*, and Axel Cloeckaert*Comments to Author 
Author affiliations: *Institut National de la Recherche Agronomique, Nouzilly, France; †Agence Française de Sécurité Sanitaire des Aliments, Masons-Alfort, France; ‡Health Canada Winnipeg, Manitoba, Canada

Main Article

Table

Primers used for polymerase chain reaction

Primer Gene Amplificationa Size (bp) Nucleotide sequence (5´–3´)
U7-L12
thdf
Left junction
500
ACACCTTGAGCAGGGCAAG
LJ-R1
int


AGTTCTAAAGGTTCGTAGTCG
104-RJ
S044
Right junction

TGACGAGCTGAAGCGAATTG
C9-L2
int2

515
AGCAAGTGTGCGTAATTTGG
104-D
yidY

500
ACCAGGGCAAAACTACACAG
cml01
floR
floR
494
TTTGGWCCGCTMTCRGAC
cml15
floR


SGAGAARAAGACGAAGAAG
int1
intI1
A
1,135
GCTCTCGGGTAACATCAAGG
aad
aadA2


GACCTACCAAGGCAACGCTA
sulTER
sul1delta
B
942
AAGGATTTCCTGACCCTG
F3
floR


AAAGGAGCCATCAGCAGCAG
F4
floR
C
598
TTCCTCACCTTCATCCTACC
F6
tetR


TTGGAACAGACGGCATGG
tetR
tetR
D
1,559
GCCGTCCCGATAAGAGAGCA
tetA
tetA


GAAGTTGCGAATGGTCTGCG
int2
groEL-intI1
E
1,338
TTCTGGTCTTCGTTGATGCC
pse1
pse-1


CATCATTTCGCTCTGCCATT
pse-L
pse-1
F
4,400
AATGGCAATCAGCGCTTCCC
MDR-B S044 GAATCCGACAGCCAACGTTCC

aSee Figure 1.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO