Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 9, Number 7—July 2003

Research

Molecular Epidemiology of O139 Vibrio cholerae: Mutation, Lateral Gene Transfer, and Founder Flush

Pallavi Garg*†, Antonia Aydanian‡, David Smith‡, J. Glenn Morris‡, G. Balakrish Nair*†, and O. Colin Stine‡Comments to Author 
Author affiliations: *National Institute of Cholera and Enteric Diseases, Calcutta, India; †International Centre for Diarrheal Diseases Research, Dacca, Bangladesh; ‡University of Maryland School of Medicine, Baltimore, Maryland, USA

Main Article

Table 1

Primers used for multilocus sequence typing

Locus Primer 1 Primer 2
dnaE
CGRATMACCGCTTTCGCCG
GAKATGTGTGAGCTGTTTGC
lap
GAAGAGGTCGGTTTGCGAGG
GTTTGAATGGTGAGCGGTTTGCT
rstR
CGTGTTAGAGCACAC
GAGTGAATCGTCGTG
gmd
CCTTATGCKGTGGCRAA
CTWGGATCACCTAACA
recA
GAAACCATTTCGACCGGTTC
CCGTTATAGCTGTACCAAGCGCCC
pgm
CCKTCSCAYAACCCGCC
TCRACRAACCATTTGAADCC
gyrB
GAAGGBGGTATTCAAGC
GAGTCACCCTCCACWATGTA
cat
ATGGCTTATGAATCGATGGG
TCCCATTGCCATGCACC
chi CAYGAYCCRTGGGCWGC ACRTCTTCAATCTTGTC

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO