Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 2, Number 3—July 1996
Dispatch

HIV-1 Group O Virus Identified for the First Time in the United States

M. A. Rayfield*, P. Sullivan†, C. I. Bandea*, L. Britvan‡, R. A. Otten*, C. P. Pau*, D. Pieniazek*, S. Subbarao*, P. Simon†, C. A. Schable*, A. C. Wright*, J. Ward†, and G. Schochetman*
Author affiliations: Author Affiliations: ; *National Center for Infectious Diseases; †National Center for HIV, STD and TB Prevention, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ‡Kaiser Permanente Medical Group, Los Angeles, California, USA

Main Article

Figure 1

Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap val

Figure 1. Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap values. The SIV-MM251 protease gene sequence and the SIV-CPZ env sequence were used as outgroups in trees A and B, respectively. The nucleotide sequence distance among strains can be deduced from the horizontal branch lengths by using the included bar scale. Vertical distances are for clarity only.

Main Article

References
  1. Loussert-Ajaka  I, Chaix  M, Korber  B, . Variablility of human immundeficiency virus type 1 roup O strains isolated from Cameroonian patients living in France. J Virol. 1995;69:5640–9.PubMedGoogle Scholar
  2. Myers  G, Korber  B, Wain-Hobson  S, Smith  R, Pavlakis  G, eds. Human retroviruses and AIDS 1994: a compilation and analysis of nucleic acid and amino acid sequences. Los Alamos, NM: Los Alamos National Laboratory, 1993.
  3. Brodine  SK, Mascola  JR, Weiss  PJ, Detection of diverse HIV-1 genetic subtypes in the USA. Lancet. 1995;346:1198–9. DOIPubMedGoogle Scholar
  4. Schable  C, Zekeng  L, Pau  CP, Sensitivity of United States HIV antibody tests for detection of HIV-1 Group O infections. Lancet. 1994;344:1333–4. DOIPubMedGoogle Scholar
  5. Identification of HIV-1 Group O Infection — Los Angeles County, California, 1996. MMWR. 1996;45:561–5.PubMedGoogle Scholar
  6. Pau  CP, Hu  DJ, Spruill  C, Surveillance for human immunodeficiency virus type 1 group O infections in the United States. Transfusion. 1996;36:398–400. DOIPubMedGoogle Scholar
  7. Bandea  C, Ramos  A, Pieniazek  D, . Epidemiologic and evolutionary relationships between Romanian and Brazilian HIV-1 subtype F strains. Emerg Infect Dis. 1995;1:91–3. DOIPubMedGoogle Scholar
  8. Pieniazek  D, Janini  LM, Ramos  A, . HIV-1 patients may harbor viruses of different phylogentic subtypes: implications for the evolution of the HIV/AIDS pandemic. Emerg Infect Dis. 1995;1:86–8. DOIPubMedGoogle Scholar
  9. Gao  F, Yue  L, Robertson  DL, . Genetic diversity of human immunodeficiency virus type 2: evidence for distinct sequence subtypes with differences in virus biology. J Virol. 1994;68:7433–47.PubMedGoogle Scholar
  10. Larsen  N, Olsen  GJ, Maidak  BN, . The ribosomal database project. Nucleic Acids Res. 1993;21:3021–3. DOIPubMedGoogle Scholar
  11. Felsenstein  J. PHYLIP-phylogeny inference package (version 3.2). Cladistics. 1989;5:164–6.

Main Article

1Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.

Page created: December 20, 2010
Page updated: December 20, 2010
Page reviewed: December 20, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external