Volume 27, Number 4—April 2021
Dispatch
Venezuelan Equine Encephalitis Complex Alphavirus in Bats, French Guiana
Table 2
Name | Sequence, 5′ → 3′ | Concentration |
---|---|---|
Forward primer | CATTGTCATAGCCAGCAGAGTTCT | 400 nM |
Reverse primer | GACTTGATACCTTTGACGATGTTGTC | 400 nM |
Probe (FAM-labeled) | CGCGAACGTCTGACCAACTCACCCT | 200 nM |
*We carried out 25 μL real-time RT-PCR reactions using the Superscript III one-step RT-PCR system with Platinum Taq polymerase (Thermo Fisher Scientific, https://www.thermofisher.com). Reactions were set up with 5 μL extracted RNA; 12.5 μL of 2× reaction buffer; 0.4 μL of a 50 mM magnesium sulfate solution; 1 μg of nonacetylated bovine serum albumin; and 1 μL enzyme. Amplification was conducted at 50°C for 15 min, followed by 95°C for 3 min and 45 cycles of 95°C for 15 s and 58°C for 30 s with fluorescence, read at the 58° annealing/extension step on a LightCycler 480 thermocycler (Roche, https://www.roche.com). FAM, fluorescein amidite; RT-PCR, reverse transcription PCR.
1These authors contributed equally to this article.
Page created: January 21, 2021
Page updated: April 06, 2021
Page reviewed: April 06, 2021
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.