Volume 27, Number 4—April 2021
Dispatch
Venezuelan Equine Encephalitis Complex Alphavirus in Bats, French Guiana
Table 2
Oligonucleotides for quantification of TONV, French Guiana*
| Name | Sequence, 5′ → 3′ | Concentration |
|---|---|---|
| Forward primer | CATTGTCATAGCCAGCAGAGTTCT | 400 nM |
| Reverse primer | GACTTGATACCTTTGACGATGTTGTC | 400 nM |
| Probe (FAM-labeled) | CGCGAACGTCTGACCAACTCACCCT | 200 nM |
*We carried out 25 μL real-time RT-PCR reactions using the Superscript III one-step RT-PCR system with Platinum Taq polymerase (Thermo Fisher Scientific, https://www.thermofisher.com). Reactions were set up with 5 μL extracted RNA; 12.5 μL of 2× reaction buffer; 0.4 μL of a 50 mM magnesium sulfate solution; 1 μg of nonacetylated bovine serum albumin; and 1 μL enzyme. Amplification was conducted at 50°C for 15 min, followed by 95°C for 3 min and 45 cycles of 95°C for 15 s and 58°C for 30 s with fluorescence, read at the 58° annealing/extension step on a LightCycler 480 thermocycler (Roche, https://www.roche.com). FAM, fluorescein amidite; RT-PCR, reverse transcription PCR.
1These authors contributed equally to this article.