Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 13, Number 8—August 2007
Dispatch

PCR versus Hybridization for Detecting Virulence Genes of Enterohemorrhagic Escherichia coli

Robert S. Gerrish*, James E. Lee*, June Reed*, Joel Williams*, Larry D. Farrell*, Kathleen M. Spiegel*, Peter P. Sheridan*, and Malcolm S. Shields*Comments to Author 
Author affiliations: *Idaho State University, Pocatello, Idaho, USA;

Main Article

Table

Virulence factor targets and primers, including nucleotide sequences, reference, and PCR conditions*

Primer name Nucleotide sequence (5′→3′) Target (bp) Ref. PCR conditions
Denature Anneal Extension
STX1U GTAACATCGCTCTTGCCACA Stx1 gene (204) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX1D CGCTTTGCTGATTTTTCACA
STX2U GTTCCGGAATGCAAATCAGT Stx2 gene (206) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX2D CGGCGTCATCGTATACACAG
eae-1 ACGTTGCAGCATGGGTAACTC Intimin (818) (8) 95°C, 60 s 57.1°C, 60 s 72°C, 240 s
eae-2 GATCGGCAACAGTTTCACCTG
ToxBF TGGCCTTGCGCTCTATAAGAACCT ToxB (823) This study 95°C, 60 s 60°C, 60 s 72°C, 240 s
ToxBR ACCACGCCGTGAGAATAATGTCCA
HlyA1F GGTGCAGCAGAAAAAGTTGTAG HlyA (1551) (13) 95°C, 60 s 55.5°C,60 s 72°C, 240 s
HlyA1R TCTCGCCTGATAGTGTTTGGTA
EspPF CGGCAGAGTATCATCAAGAGC EspP (397) This study 95°C, 60 s 55.5°C, 60 s 72°C, 240 s
EspPR CATTAAATGGAGTTATGCGTC
KatPF TTTAAAACGCTGGGATTTGC KatP (1174) This study 95°C,60 s 52.0°C, 60 s 72°C, 240 s
KatPR CTCCTGAGAGGCGTCAGTTC
MalBU GACCTCGGTTTAGTTCACAGA MalB promoter (414) This study 95°C, 60 s 55.8°C, 60 s 72°C, 240 s
MalBDn AGCGCGTAGGACTGAAACACCATA
ORF1F TTTTTCAAAGCAAATGATGTGG ORF 1
pOSAK1 (385) This study 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
ORF1R GGCGTAGCTAGGTTGAAATTATG
ORF2F CAA CCTAGCTACGCCACCAT ORF 2
pOSAK1 (869) This study 95°C, 60 s 54.3°C, 60 s 72°C, 240 s
ORF2R CATCAGGCGGAAATACCACT
EAF1 CAGGGTAAAAGAAAGATGATAA Eaf (397) (14) 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
EAF2 TATGGGGACCATGTATTATCA
BFP1 GATTGAATCTGCAATGGC Bfp (597) (15) 95°C, 60 s 51.6°C, 60 s 72°C, 240 s
BFP2 GGATTACTGTCCTCACATAT

*Ref., reference; ORF, open reading frame.

Main Article

References
  1. Nataro  JP, Kaper  JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201.PubMedGoogle Scholar
  2. Makino  S, Tobe  T, Asakura  H, Watarai  M, Ikeda  T, Takeshi  K, Distribution of the secondary type III secretion system locus found in enterohemorrhagic Escherichia coli O157:H7 isolates among Shiga toxin–producing E. coli strains. J Clin Microbiol. 2003;41:2341–7. DOIPubMedGoogle Scholar
  3. Hacker  J, Kaper  JB. Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000;54:641–79. DOIPubMedGoogle Scholar
  4. Burland  V, Shao  Y, Perna  NT, Plunkett  G. Sofia HJBlattner FR. The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic Acids Res. 1998;26:4196–204. DOIPubMedGoogle Scholar
  5. Farmer  JJ III, Davis  BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol. 1985;22:620–5.PubMedGoogle Scholar
  6. Osek  J. Development of a multiplex PCR approach for the identification of Shiga toxin–producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol. 2003;95:1217–25. DOIPubMedGoogle Scholar
  7. Prager  R, Annemuller  S, Tschape  H. Diversity of virulence patterns among Shiga toxin–producing Escherichia coli from human clinical cases-need for more detailed diagnostics. Int J Med Microbiol. 2005;295:29–38. DOIPubMedGoogle Scholar
  8. Blanco  JE, Blanco  M, Blanco  J, Mora  A, Balaguer  L, Mourino  M, O serogroups, biotypes, and eae genes in Escherichia coli strains isolated from diarrheic and healthy rabbits. J Clin Microbiol. 1996;34:3101–7.PubMedGoogle Scholar
  9. Brunder  W, Schmidt  H, Frosch  M, Karch  H. The large plasmids of Shiga-toxin–producing Escherichia coli (STEC) are highly variable genetic elements. Microbiology. 1999;145:1005–14. DOIPubMedGoogle Scholar
  10. Makino  K, Ishii  K, Yasunaga  T, Hattori  M, Yokoyama  K, Yutsudo  CH, Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli O157:H7 derived from Sakai outbreak. DNA Res. 1998;5:1–9. DOIPubMedGoogle Scholar
  11. Brunder  W. Schmidt H, Karch H. KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology. 1996;142:3305–15. DOIPubMedGoogle Scholar
  12. Tatsuno  I, Horie  M, Abe  H, Miki  T, Makino  K, Shinagawa  H, toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660–9. DOIPubMedGoogle Scholar
  13. Schmidt  H, Beutin  L, Karch  H. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995;63:1055–61.PubMedGoogle Scholar
  14. Franke  J, Franke  S, Schmidt  H, Schwarzkopf  A, Wieler  LH, Baljer  G, Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994;32:2460–3.PubMedGoogle Scholar
  15. Wieler  LH, Vieler  E, Erpenstein  C, Schlapp  T, Steinruck  H, Bauerfeind  R, Shiga toxin-producing Escherichia coli strains from bovines: association of adhesion with carriage of eae and other genes. J Clin Microbiol. 1996;34:2980–4.PubMedGoogle Scholar

Main Article

Page created: June 30, 2010
Page updated: June 30, 2010
Page reviewed: June 30, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external