Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 10, Number 7—July 2004


Molecular Analysis of Plasmodium ovale Variants

Thin Thida Win*, Amadu Jalloh*, Indah Setyawati Tantular†, Takafumi Tsuboi‡, Marcelo Urbano Ferreira§, Masatsugu Kimura¶, and Fumihiko Kawamoto*Comments to Author 
Author affiliations: *Nagoya University Graduate School of Medicine, Nagoya, Japan; †Airlangga University, Surabaya, Indonesia; ‡Ehime University, Matsuyama, Ehime, Japan; §University of São Paulo, São Paulo, Brazil; ¶Osaka City University Medical School, Osaka, Japan

Main Article

Table 1

Oligonucleotide primers used in this study

Target gene
Sequences (5′→3′)
Cysteine protease gene CysP-F GCCAGTGTAGGTAATATTGAAT
Ookinete surface protein genes
First polymerase chain reaction (PCR)
Nested PCR

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO