Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 2—February 2005

Dispatch

Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens

Thomas Briese*1, Gustavo Palacios*1, Mark Kokoris†1, Omar Jabado*, Zhiqiang Liu*, Neil Renwick*, Vishal Kapoor*, Inmaculada Casas‡, Francisco Pozo‡, Ron Limberger§, Pilar Perez-Brena‡, Jingyue Ju*, and W. Ian Lipkin*Comments to Author 
Author affiliations: *Columbia University, New York, New York, USA; †Qiagen Inc., Valencia, California, USA; ‡Instituto de Salud Carlos III, Majadahonda, Madrid, Spain; §New York State Department of Health, Albany, New York, USA

Main Article

Table A1

Respiratory panel Mass Tag primers.

Target – Masscode FWD/REV Name FWD Sequence Name REV Sequence Ref.
FLUAV-M 618/690 AM-U151 CATGGAATGGCTAAAGACAAGACC AM-L397 AAGTGCACCAGCAGAATAACTGAG (8)
FLUAV-N1 499/439 NA1-U1078 ATGGTAATGGTGTTTGGATAGGAAG NA1-L1352 AATGCTGCTCCCACTAGTCCAG (8)
FLUAV-N2 658/730 NA2-U560 AAGCATGGCTGCATGTTTGTG NA2-L858 ACCAGGATATCGAGGATAACAGGA (8)
FLUAV-HA1 650/590 HA1-U583 GGTGTTCATCACCCGTCTAACAT HA1-L895 GTGTTTGACACTTCGCGTCACAT (8)
FLUAV-HA2 662/539 H2A208U27 GCTATGCAAACTAAACGGAATYCCTCC H2A559L26 TATTGTTGTACGATCCTTTGGCAACC
FLUAV-HA3-1 586/475 HA3-U115 GCTACTGAGCTGGTTCAGAGTTC HA3-L375 GAAGTCTTCATTGATAAACTCCAG (8)
FLUAV-HA5 646/395 HA5hum-u71 TTACTGTTACACATGCCCAAGACA HA5hum-L147 AGGYTTCACTCCATTTAGATCGCA
FLUBV 698/598
BHA-U188
AGACCAGAGGGAAACTATGCCC
BHA-L347
CTGTCGTGCATTATAGGAAAGCAC
(8)
HCoV-SARS 527/666 CIID-28891F AAGCCTCGCCAAAAACGTAC CIID-29100R AAGTCAGCCATGTTCCCGAA
HCoV-229E 670/558 Taq-Co22-418F GGCGCAAGAATTCAGAACCA Taq-Co22-636R TAAGAGCCGCAGCAACTGC
HCoV-OC43 686/548
Taq-Co43-270F
TGTGCCTATTGCACCAGGAGT
Taq-Co43-508R
CCCGATCGACAATGTCAGC

RSV A 467/455 RSA-U1137 AGATCAACTTCTGTCATCCAGCAA RSV-L1192 GCACATCATAATTAGGAGTATCAAT (9)
RSV B 483/479
RSB-U1248
AAGATGCAAATCATAAATTCACAGGA
RSV-1318
TGATATCCAGCATCTTTAAGTATCTTTATAGTG
(9)
HMPV-1 718/654 MPV01.2 AACCGTGTACTAAGTGATGCACTC MPV02.2 CATTGTTTGACCGGCCCCATAA (10)
HMPV-2 718/654
MV-Can-U918
AAGTCCAAAGGCAGGRCTGTTATC
MV-Can-L992
CCTGAAGCATTRCCAAGAACAACAC

HPIV-1 566/357 HPIV1-U82 TACTTTTGACACATTTAGTTCCAGGAG HPIV1-L167 CGGTACTTCTTTGACCAGGTATAATTG
HPIV-2 463/590 HPIV2-U908 GGACTTGGAACAAGATGGCCT HPIV2-L984 AGCATGAGAGCYTTTAATTTCTGGA
HPIV-3 423/539 HPIV3-U590 GCTTTCAGACAAGATGGAACAGTG HPIV3-L668 GCATKATTGACCCAATCTGATCC
HPIV 4A 622/606 HPIV4A-U191 AACAGAAGGAAATGATGGTGGAAC HPIV4A-L269 TGCTGTGGATGTATGGGCAG
HPIV 4B 622/606
HPIV4B-U194
AGAAGAAAACAACGATGAGACAAGG
HPIV4B-L306
GTTTCCCTGGTTCACTCTCTTCA

Measles 578/562 MEA-U1103 CAAGCATCATGATYGCCATTCCTGG MEA-L1183 CCTGAATCYCTGCCTATGATGGGTTT
Adenovirus 503/630 ADV2HEX2F CCCMTTYAACCACCACCG ADVHEX1R ACATCCTTBCKGAAGTTCCA (11)
Enterovirus 702/495 5UTR-U447 TCCTCCGGCCCCTGAATGCGGCTAATCC 5UTR-L541 GAAACACGGWCACCCAAAGTASTCG
HHV-1 443/706 HSV-U27 CCCGGATGCGGTCCAGACGATTAT HSV-L121 CCCGCGGAGGTTGTACAAAAAGCT
HHV-3 515/471 VZV-U138 ACGTGGATCGTCGGATCAGTTGT VZV-L196 TCGCTATGTGCTAAAACACGCGG
Legionella pneumophila 678/582 LegPneu-U149 GCATWGATGTTARTCCGGAAGCA LegPneu-L223 CGGTTAAAGCCAATTGAGCG
Chlamydia pneumoniae 519/383 CLPM1 CATGGTGTCATTCGCCAAGT CLPM2 CGTGTCGTCCAGCCATTTTA (12)
Streptococcus pneumonia 714/694 SPPLY-U532 AGCGATAGCTTTCTCCAAGTGG SPPLY-L606 CTTAGCCAACAAATCGTTTACCG
Haemophilus influenzae 734/726 HINF-U82 AAGCTCCTTGMATTTTTTGTATTAGAA Hinf-L158 GCTGAATTGGCTTRGATACCGAG
Mycoplasma pneumoniae 602/614 MTPM1 CCAACCAAACAACAACGTTCA MTPM2 ACCTTGACTGGAGGCCGTTA (12)

Main Article

1These authors contributed equally to this study.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO