Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 2—February 2005

Research

Bacterial Zoonoses and Infective Endocarditis, Algeria

Akila Benslimani*1, Florence Fenollar†1, Hubert Lepidi†, and Didier Raoult†Comments to Author 
Author affiliations: *Service de Biologie Clinique, Alger, Algérie; †Université de la Méditerranée, Marseille, France

Main Article

Table 1

Primers used for broad-range 16S rRNA polymerase chain reaction (PCR) and, according to species identified by sequencing, primers targeting a second gene for confirmation of positive 16S rRNA PCR results and primers used for fungal PCR

Microorganisms Gene Forward primer Reverse primer
Eubacteria 16S rRNA 536f 5′ CAGCAGCCGCGGTAATAC RP2 5′ ACGGCTACCTTGTTACGACTT
Staphylococcus spp. RpoB StphF 5′ AAACCIATACGCAATTGGTT StphR 5′ GTTTCATGACTTGGGACGG
Streptococcus spp. RpoB StrpF 5′ AARYTIGGMCCTGAAGAAAT StrpR 5′ TGIARTTTRTCATCAACCATGTG
Enterococcus spp. RpoB StrpF 5′ AARYTIGGMCCTGAAGAAAT StrpR 5′ TGIARTTTRTCATCAACCATGTG
Streptococcus spp. SOD d1 5′ CCITAYICITAYGAYGCIYTIGARCC d2 5′ ARRTARTAIGCRTGYTCCCAIACRTC
Enterobacteriaceae RpoB CM7 5′ AACCAGTTCCGCGTTGGCCTGG CM31b 5′ CCTGAACAACACGCTCGGA
Mycoplasma hominis FtsY MH1F 5′ GTGTTGTATCGACAACAG MH1R 5′ GTGTTGTATCGACAA
Coxiella burnetii IS111 Trans3 5′ CAACTGTGTGGAATTGATGA Trans5 5′ TTTACATGACGCAATAGCGC
Bartonella spp. ITS ITSF1 5′ GCGACTGGGGTGAAGTGG ITSR1 5′ AGGCTTGGGATCATCATC
Bacillus spp. RpoB Bc55F 5′ TCTCGTATGGAACGTGTTGT Bc260R 5′ TGAACGTCACGYACTTCAAA
Corynebacterium spp. RpoB C2700F 5′ GWATGAACATYGGBCAGGT C3130R 5′ TCCATYTCRCCRAARCGCT
Fungi 18S-28S ITS FCU 5′ TCCGTAGGTGAACCTGCGG RCU 5′ GCTGCGTTCTTCATCGATGC

Main Article

1These 2 authors have contributed equally to the manuscript.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO