Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 4—April 2007

Research

Global Emergence of Trimethoprim/Sulfamethoxazole Resistance in Stenotrophomonas maltophilia Mediated by Acquisition of sul Genes

Mark A. Toleman*, Peter M. Bennett*, David M.C. Bennett*, Ronald N. Jones†, and Timothy R. Walsh*Comments to Author 
Author affiliations: *School of Medicine at Cardiff University, Cardiff, Wales; †The JONES Group/JMI Laboratories, North Liberty, Iowa, USA;

Main Article

Table

Oligonucleotide primers used in this study, Cardiff, 2007

Primer Sequence (5′→3′) GenBank accession no. Target Reference
Ina-F
GCCTGTTCGGTTCGTAAGCT

intI
(14)
Int-R
CGGATGTTGCGATTACTTCG

intI
(14)
sul1-F
ATGGTGACGGTGTTCGGCATTCTGA

sul1
(15)
sul1-R
CTAGGCATGATCTAACCCTCGGTCT

sul1
(15)
sul2-F
GAATAAATCGCTCATCATTTTCGG
AJ289135
sul2
(15)
sul2-R
CGAATTCTTGCGGTTTCTTTCAGC
AJ289135
sul2
(15)
aacA4-F
AACTTGCGAGCGATCCGATG

aacA4
(14)
aacA4-R
ATGTACACGGCTGGACCATC

aacA4
(14)
aacA7-F
AATGGATAGTTCGCCGCTCG

aacA7
This study
aacA7-R
TTCCGGAAGCAGCGTACTTG

aacA7
This study
CRF
CACTWCCACATGCTGTKKC
AF231986
All ISCR
This study
CRF-r
GMMACAGCATGTGGWAGTG
AF231986
All ISCR
This study
CRFF
GGRYGCAACGSCTCAAGCG
AF231986
All ISCR
This study
CRFF-r
CGCTTGAGSCGTTGCRYCC
AF231986
All ISCR
This study
LECR2
CACTGGCTGGCAATGTCTAG
AF231986
ISCR2
This study
RECR2
CTTTGGACCGCAGTTGACTC
AF231986
ISCR2
This study
FloF
TCGACATCCTGGCTTCACTG
AF231986
floR
This study
FloR
ATTACAAGCGCGACAGTGGC
AF231986
floR
This study
dfra20f
GGGAAACACCGAGAAATGGG
AJ605332
dfrA20
This study
dfrA20R
TTCTTCTTCCCATTCTCCCC
AJ605332
dfrA20
This study
dfrA9F
CAGATTCCGTGGCATGAACC
X57730
dfrA9
This study
dfrA9R
GACCTCAGATACGAGTTTCC
X57730
dfrA9
This study
dfrA10F
TGTAGCGCGTGGTGTAAACG
AY055428
dhfr10
This study
dfrA10R
ACGTCTACGTGAGTATCCGC
AY055428
dhfr10
This study
strAF
TCTGTCGCACCTGCTTGATC
AY055428
strA
This study
strAR
CATTGCTGATGAACTGCGCG
AY055428
strA
This study
tetAF
CGCTGTTTGTGATTACACCC
AJ250203
tetA
This study
tetAR
CAGCGAGATGCGATATATCC
AJ250203
tetA
This study
glmmR
GAGTCAACTGCGGTCCAAAC
AJ289135
glmM
This study
glmmF ACGGTATTCGTGGCAAAGCC AJ289135 glmM This study

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO