Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 5—May 2007


Fatal Disseminated Acanthamoeba lenticulata Acanthamebiasis in a Heart Transplant Patient

Stéphane Barete*Comments to Author , Alain Combes†, Johan F. de Jonckheere‡, Annick Datry†, Shaïda Varnous†, Valérie Martinez†, Sara García Ptacek*, Eric Caumes†, Frédérique Capron†, Camille Francès*, Claude Gibert†, and Olivier Chosidow*
Author affiliations: *Hôpital Tenon, Paris, France; †Hôpital Pitié-Salpêtrière, Paris, France; ‡Scientific Institute of Public Health, Brussels, Belgium;

Main Article


rDNA sequences of Acanthamoeba isolate (2/533) from the patient, a keratitis isolate (GAK1), 3 environmental T5 subtypes, and 4 other genotypes from persons with nonkeratitis infections

Genotype (strain) DF3 sequence (5′→3′)*
T5 (GAK1) caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat
T5 (72/2)† caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat
T5 (PD2S)‡ caaaacaccgctgttaatccttt-----cgggggttaatagttggtgaat
T5 (FLAIV)§ caaaacaccgccgttaatcctttt-caacgggggttaacggttggtgaat
T4 caaaacacca-Atcggcgcggtcgtccttggcgtcggtccttcacggggccggcgcgagggcggcttagcccggtggcacc
T1 caaaacacca-ccatcaggcagtggggtcgtgcttcgcttttccggcaacggggaagtggaggcggtctcattcccctgatgg
T10 caaaacaccatccatttagcayggtcgttttcaaatattcctttttgcgaaggttgtttgggaacgattcgtcctgatggatc
T12 caaaacacca-ccattaacacgatcgttttttgcaaatatgccacatgcgcaagtgtgtggttgtgtttgaaggaacgatttg

*Sequences differences are shown in boldface.
†Five isolates at European Molecular Biology Laboratory (EMBL).
‡Eight isolates at EMBL.
§One isolate at EMBL.

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO