Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 8—August 2007

Dispatch

PCR versus Hybridization for Detecting Virulence Genes of Enterohemorrhagic Escherichia coli

Robert S. Gerrish*, James E. Lee*, June Reed*, Joel Williams*, Larry D. Farrell*, Kathleen M. Spiegel*, Peter P. Sheridan*, and Malcolm S. Shields*Comments to Author 
Author affiliations: *Idaho State University, Pocatello, Idaho, USA;

Main Article

Table

Virulence factor targets and primers, including nucleotide sequences, reference, and PCR conditions*

Primer name Nucleotide sequence (5′→3′) Target (bp) Ref. PCR conditions
Denature Anneal Extension
STX1U GTAACATCGCTCTTGCCACA Stx1 gene (204) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX1D CGCTTTGCTGATTTTTCACA
STX2U GTTCCGGAATGCAAATCAGT Stx2 gene (206) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX2D CGGCGTCATCGTATACACAG
eae-1 ACGTTGCAGCATGGGTAACTC Intimin (818) (8) 95°C, 60 s 57.1°C, 60 s 72°C, 240 s
eae-2 GATCGGCAACAGTTTCACCTG
ToxBF TGGCCTTGCGCTCTATAAGAACCT ToxB (823) This study 95°C, 60 s 60°C, 60 s 72°C, 240 s
ToxBR ACCACGCCGTGAGAATAATGTCCA
HlyA1F GGTGCAGCAGAAAAAGTTGTAG HlyA (1551) (13) 95°C, 60 s 55.5°C,60 s 72°C, 240 s
HlyA1R TCTCGCCTGATAGTGTTTGGTA
EspPF CGGCAGAGTATCATCAAGAGC EspP (397) This study 95°C, 60 s 55.5°C, 60 s 72°C, 240 s
EspPR CATTAAATGGAGTTATGCGTC
KatPF TTTAAAACGCTGGGATTTGC KatP (1174) This study 95°C,60 s 52.0°C, 60 s 72°C, 240 s
KatPR CTCCTGAGAGGCGTCAGTTC
MalBU GACCTCGGTTTAGTTCACAGA MalB promoter (414) This study 95°C, 60 s 55.8°C, 60 s 72°C, 240 s
MalBDn AGCGCGTAGGACTGAAACACCATA
ORF1F TTTTTCAAAGCAAATGATGTGG ORF 1
pOSAK1 (385) This study 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
ORF1R GGCGTAGCTAGGTTGAAATTATG
ORF2F CAA CCTAGCTACGCCACCAT ORF 2
pOSAK1 (869) This study 95°C, 60 s 54.3°C, 60 s 72°C, 240 s
ORF2R CATCAGGCGGAAATACCACT
EAF1 CAGGGTAAAAGAAAGATGATAA Eaf (397) (14) 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
EAF2 TATGGGGACCATGTATTATCA
BFP1 GATTGAATCTGCAATGGC Bfp (597) (15) 95°C, 60 s 51.6°C, 60 s 72°C, 240 s
BFP2 GGATTACTGTCCTCACATAT

*Ref., reference; ORF, open reading frame.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO