Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 12—December 2008

Research

Genetic Characterization of Toggenburg Orbivirus, a New Bluetongue Virus, from Goats, Switzerland

Martin A. HofmannComments to Author , Sandra Renzullo, Markus Mader, Valérie Chaignat, Gabriella Worwa, and Barbara Thuer
Author affiliations: Institute of Virology and Immunoprophylaxis, Mittelhaeusern, Switzerland

Main Article

Table 1

Terminal primers used to amplify complete Toggenburg orbivirus RNA segments

RNA segment Name*
Sequence (5′ → 3′)
Forward primer
2 BTV4&10_S2_-21_F GGGTTAAAAGAGTGTTCYAC
5 BTV_S5_F GTTAAAAAAGTTCTCTAGTTGGCA
6 BTV4&10&11_S6_-30_F GTTAAAAAGTRTTCTCCTACTC
7 BTV_S7_-17_F GTTAAAAATCTATAGAGATGGAC
8 BTV_S8_-19_F GTTAAAAAAWCCTTGAGTCATG
9 BTV_S9_-15_F GTTAAAAAATCGCATATGTCAG
10 BTV_S10_F GTTAAAAAGTGTCGCTGCCAT
Reverse primer
2 BTV4&20_S2_R GTAAGTGTAAGAAGGCCACAG
5 BTV_S5_R GTAAGTTGAAAAGTTCTAGTAGAG
6 BTV4&10_S6_1618_R GTAAGTGTAATCTTCTCCCTC
7 BTV_S7_1142_R GTAAGTGTAATCTAAGAGACGT
8 BTV_S8_1106_R GTAAGTGTAAAATCCCCCCC
9 BTV_S9_1038_R GTAAGTRTGAAATCGCCCTAC
10 BTV_S10_R ACCTYGGGGCGCCACTC

*BTV, bluetongue virus.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO