Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 4—April 2008

Research

Clonal Population of Flucytosine-Resistant Candida tropicalis from Blood Cultures, Paris, France

Marie Desnos-Ollivier*, Stéphane Bretagne*†, Claire Bernède*‡, Vincent Robert§, Dorothée Raoux*, Elisabeth Chachaty¶, Elisabeth Forget#, Claire Lacroix**, Françoise Dromer*Comments to Author , and the YEASTS group
Author affiliations: *Institut Pasteur, Paris, France; †Hôpital Henri Mondor–Assistance Publique Hôpitaux de Paris, Créteil, France; ‡Institut Pasteur Institut National de la Santé et de la Recherche Médicale Unité 657, Paris, France; §Centraal Bureau voor Schimmelcultures, Utrecht, the Netherlands; ¶Institut Gustave-Roussy, Villejuif, France; #Hôpital Beaujon, Clichy, France; **Hôpital Saint Louis, Paris, France;

Main Article

Table 1

Primers sequences and amplification parameters used in the present study

Locus Primer 5′ labeling Sequence (5′ → 3′)* Annealing temperature, °C
14αDM† DMC1 >TGGGTGGTCAACATACTTC 50
DMC2‡ <CATCTRTGTCTACCACCACC
Actin ACTa >AAGGTATTATGGTTGGTATGG 55
ACTb <TCGAAATCTAAAGCAACGTAA
URA3 URAF HEX§ >ATTGGATAGTCCCTCTAAACTCACTACTA 55
URAr <AGCATTAGTTATATCACTCCACGATGAA
URAF2 >TGCCGATATTGGAAATACAGTTA 50
URAr2 <AATCAACTATTCAAGTTGACCG
CTU2 <GTTGGAACATCAATTGATGCACATAAAT 55
Unknown CT14a 6FAM¶ >GTAAATCTTGTATACCGTGGA 55
CT14b <TAGCCCATTTTCTAGTTTTGC
FCY1 CTCDf >ATCATTAGTTCAGATGGTAAAGTCTTG 58
CTCDr <CCTTTTTAGTAACATGTCTATTCTCCA
FCY2 CTCP1f >TGCCCATAAATTAAATGCAGAA 58
CTCP1r <GGAAGCAACAAACCCAAAAA
FCY2 CTCP2f >TGCTGCCGATTATGTTGTTT 58
CTCP2r <GTGAAAACGAGCCAATCCAT
FUR1 FUR1f >TCATCAAAACCATGTCTGCTG 58
FUR1r <AAGTGTATGTAGTGATAATTGCTATGC

*>, Sense primer; <, antisense primer.
†14 α demethylase.
‡R = G or A.
§4, 7, 2′,4′, 5′,7′-hexachloro-6-carboxyfluorescein.
¶6-carboxyfluorescein.

Main Article

1The YEASTS group is composed of (in alphabetical order by city): Claire Bouges-Michel (Hôpital Avicenne, Bobigny), Isabelle Poilane (Hôpital Jean Verdier, Bondy), Marie-Elisabeth Bougnoux, Jean Dunand (Hôpital Ambroise Paré, Boulogne), Guy Galeazzi (Hôpital Louis Mourier, Colombes), Stéphane Bretagne, Françoise Botterel (Hôpital Henri Mondor, Créteil), Nathalie Fauchet (Centre Hospitalier Intercommunal de Créteil, Créteil), Elisabeth Forget (Hôpital Beaujon, Clichy), Françoise Botterel, Christine Bonnal (Hôpital du Kremlin Bicêtre), Odile Eloy (Hôpital Mignot, Le Chesnay), Christine Lawrence (Hôpital Raymond Poincaré, Garches), Marie-Françoise David, Liliana Mihaila (Hôpital Paul Brousse, Villejuif), Elisabeth Chachaty, Olivier Adam (Institut Gustave Roussy, Villejuif), and in Paris: Christian Chochillon (Hôpital Bichat), André Paugam, Marie-Thérèse Baixench (Hôpital Cochin), Muriel Cornet (Hôpital de l’Hôtel Dieu), Marie-Christine Escande (Institut Curie), Svetlana Challier, Marie-Elisabeth Bougnoux (Hôpital Necker), Eric Dannaoui (Hôpital Européen Georges Pompidou), Annick Datry, Houria Laklache, Bader Lmimouni, Sophie Brun (Hôpital de la Pitié-Salpétrière), Jean-Louis Poirot (Hôpital Saint Antoine), Claire Lacroix (Hôpital Saint Louis), Didier Moissenet (Hôpital Trousseau), Michel Develoux (Hôpital Tenon), and Stéphane Bonacorsi (Hôpital Robert Debré).

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO