Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 5—May 2008

Dispatch

Spread of Streptococcus suis Sequence Type 7, China

Changyun Ye*†1, Xuemei Bai†1, Ji Zhang†1, Huaiqi Jing†1, Han Zheng*1, Huamao Du†, Zhigang Cui†, Shouying Zhang†, Dong Jin*, Jianguo Xu*†Comments to Author , Yanwen Xiong*, Ailan Zhao*, Xia Luo*, Qiangzheng Sun*, Marcelo Gottschalk‡, and Yanmei Xu*Comments to Author 
Author affiliations: *State Key Laboratory for Infectious Disease Prevention and Control, Beijing, People’s Republic of China; †National Institute for Communicable Disease Control and Prevention, Changping, People’s Republic of China; ‡Université de Montréal, Montréal, Québec, Canada;

Main Article

Table 2

Primers used to detect tet genes and conjugative transposon Tn916 in Streptococcus suis*

Gene Primers (5′ → 3′) Product size, bp Annealing
temperature, °C
tetA GCTACATCCTGCTTGCCTTC; CATAGATCGCCGTGAAGAGG 210 55
tetB TTGGTTAGGGGCAAGTTTTG; GTAATGGGCCAATAACACCG 659 55
tetC CTTGAGAGCCTTCAACCCAG; ATGGTCGTCATCTACCTGCC 418 55
tetD AAACCATTACGGCATTCTGC; GACCGGATACACCATCCATC 787 55
tetE AAACCACATCCTCCATACGC; AAATAGGCCACAACCGTCAG 278 55
tetG GCTCGGTGGTATCTCTGCTC; AGCAACAGAATCGGGAACAC 468 55
tetK TCGATAGGAACAGCAGTA; CAGCAGATCCTACTCCTT 169 55
tetL TCGTTAGCGTGCTGTCATTC; GTATCCCACCAATGTAGCCG 267 55
tetM GTGGACAAAGGTACAACGAG; CGGTAAAGTTCGTCACACAC 406 55
tetO AACTTAGGCATTCTGGCTCAC; TCCCACTGTTCCATATCGTCA 515 55
tetQ TTATACTTCCTCCGGCATCG; ATCGGTTCGAGAATGTCCAC 904 55
tetS CATAGACAAGCCGTTGACC; ATGTTTTTGGAACGCCAGAG 667 55
ORF 24 ATGAGGTGTCTATTTTTTTA; TTATTGGCTGAATGAATGTT 120 52
ORF 23 AATTTGTGATTCCCAACATG; CGTCAGCATGTAAAAGGTAA 315 52
ORF 22 ATGATGAGATTAGCAAATGG; CTATTTGTCTTGTGTCGGTT 387 52
ORF 21 TTTCATTTTACGATAGCGTC; GTCGCCTGCGTGGACTGTCT 1,308 55
ORF 20 ATGCTGTTTGATTATGTAAG; TTATTTTTTTGTTGTTATCA 990 52
ORF 19 ATGAATTTTGGACAAAACCT; TTAAGCACCAATAATGCGAT 222 52
ORF 18 TTTAGGCAAATACAATGAGG; GATTGGTTGAGATAAACGTT 443 56
ORF 17 ATGGGATTTTTGAAATCGTC; TTAATTGGATATGCCATAAA 507 52
ORF 16 ATGGCATATCCAATTAAATA; TTACACCTCTTTTCGCACAG 2,448 52
ORF 15 ATGTGAAACCATCAATAGTA; TCATCTGAAAATAAAATGGC 2,265 52
ORF 14 ATGAAGTTGAAAACTTTAGT; TCATTGTTTGATTCGTCCTG 1,002 52
ORF 13 AGAAAAACAGATACCAAAGG; CGTTCTTTTCAAGTACCAAA 860 54
ORF 12-tetM ATGCTTTGTATGCCTATGGT; CTAAGTTATTTTATTGAACA 2022 54
ORF 5–10 ATTATAAACTACAAGTGGAT; TTCGTTTAATCTGAATACGA 2233 52
Xis-Tn ATGAAGCAGACTGACATTCC; TTCGTTTAATCTGAATACGA 204 52
Int-Tn GACTGGAGAGAGCCAACGAA; CATCATGCCGTTGTAATCAC 925 54

*tet, tetracycline; ORF, open reading frame.

Main Article

1These authors contributed equally to this article.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO