Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 1—January 2009


Clonal Multidrug-Resistant Corynebacterium striatum Strains, Italy

Floriana Campanile, Edoardo Carretto, Daniela Barbarini, Annalisa Grigis, Marco Falcone, Antonio Goglio, Mario Venditti, and Stefania StefaniComments to Author 
Author affiliations: University of Catania, Catania, Italy (F. Campanile, S. Stefani); Policlinico “San Matteo,” Pavia, Italy (E. Carretto, D. Barbarini); Ospedali Riuniti, Bergamo, Italy (A. Grigis, A. Goglio); University Roma La Sapienza, Rome, Italy (M. Falcone, M. Venditti)

Main Article

Table 1

Primer conditions, PCR products, and related sequences confirmed by BLAST analysis of 36 strains of multidrug-resistant Corynebacterium striatum, Italy, 2005–2007*

Primer Related resistance Sequence (5′ → 3′) Temperature, °C Size, bp BLAST from–to, bp
ermX up
ermX down Erythromycin and
ACCAGGAAGCGGTGCCCT 57 566 2,285–2,850
tetA up
tetB down Tetracycline, oxytetracycline,
AACTGGGTGCCTTCAGGGTC 58 1,829 5,496–7,324
cmxB up
cmxA down Cloramphenicol (2 identical subunits) AGTCGGTATGGTCGTCGGC
GCTCCGATATTCAATGCTGCG 57 879 16,031–16,909
aphA1 up
aphA1 down Aminoglycoside GGCAAGATCCTGGTATCGGTCT
repB up
CTGGTTGATAGACCCCGTGT 57 875 32,523–33,397

*BLAST ( analysis of each gene with pTP10 sequence (GenBank accession no. AF024666) showed nucleotide identities >99%.

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO