Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 1—January 2009

Dispatch

Rickettsia helvetica in Dermacentor reticulatus Ticks

Marinko DobecComments to Author , Dragutin Golubic, Volga Punda-Polic, Franz KaeppeliComments to Author , and Martin Sievers
Author affiliations: Medizinische Laboratorien Dr F. Kaeppeli, Zurich, Switzerland (M. Dobec, F. Kaeppeli); University of Split School of Medicine, Split, Croatia (M. Dobec, V. Punda-Polic); County Hospital, Cakovec, Croatia (D. Golubic); Split University Hospital, Split (V. Punda-Polic); Zurich University of Applied Sciences, Waedenswil, Switzerland (M. Sievers)

Main Article

Table 1

Primers and probes designed for real-time PCR*

Species Primers and probe Sequence (5′ → 3′)
Rickettsia helvetica ompB_forward GATTTCGACGGTAAAATTACC
ompB_reverse GCTACCGATATTACCTACAG

ompB_probe†
ACTCTACTGCTACAAGTATGGTTGCTACAG
R. slovaca ompA_forward GTGATAATGTTGGCAATAATAATTGG
ompA_reverse CTCTCGTTATAATCGAACCAAC

ompA_probe†
CAGCAGGAGTACCATTAGCTACCCCTCC
Dermacentor spp. ITS_forward GTGCGTCCGTCGACTCGTTTTGA
ITS_reverse ACGGCGGACTACGACGGAATGC

*Amplified products: 162 bp (R. helvetica); 228 bp (R. slovaca); 646 bp (D. reticulatus); standard curve: slope; Y-intercept and correlation coefficient:
–3.634, 40.129, 0.9937 (R. helvetica); –0.23, 42.82, 0.9942 (R. slovaca); ITS, internal transcribed spacer.
†The TaqMan probes were labeled with the fluorescent dyes FAM at the 5' end and TAMRA as quencher at the 3' end.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO