Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 11—November 2009


Rickettsia massiliae in the Canary Islands

Isabel G. Fernández de Mera, Zorica Zivkovic, Margarita Bolaños, Cristina Carranza, José Luis Pérez-Arellano, Carlos Gutiérrez, and José de la FuenteComments to Author 
Author affiliations: Instituto de Investigación en Recursos Cinegéticos IREC (Consejo Superior de Investigaciones Cientificas–Universidad de Castilla-La Mancha–Junta de Comunidades de Castilla-La Mancha), Ciudad Real, Spain (I.G. Fernández de Mera, J. de la Fuente); Utrecht University, the Netherlands (Z. Zivkovic); Hospital Universitario Insular de Gran Canaria, Canary Islands, Spain (M. Bolaños, C. Carranza, J.L. Pérez-Arellano); Universidad de Las Palmas de Gran Canaria, Canary Islands (J.L. Pérez-Arellano, Carlos Gutiérez); Oklahoma State University, Stillwater, Oklahoma, USA (J. de la Fuente).

Main Article


Rickettsia massiliae PCR conditions and amplicon size, Canary Islands, 2008*

Gene Description
(GenBank accession no.) Primer sequence (5′ → 3′) Amplicon size, bp PCR annealing conditions
16S rRNA 16S ribosomal RNA
ompB Outer membrane protein (GQ144450) F: GGGTGCTGCTACACAGCAGAA
dnaK Heat-shock protein 70
dnaA Chromosomal replication initiation protein (GQ144449) F: CCTACTAACTTTGTTAGAGATT
recA RecA recombination protein (GQ144452) F: TGCTTTTATTGATGCCGAGC
atpA ATP synthase F1 alpha subunit (GQ144448) F: ACATATCGAGATGAAGGCTCC

*GenBank accession numbers correspond to R. massiliae sequences identified in this study. PCRs were completed by employing the Access RT-PCR system (Promega, Madison, WI, USA) with 1 ng DNA, the oligonucleotide primers, and annealing conditions and with extension for 1 min at 68ºC. F, forward; R, reverse.

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO