Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 12—December 2009

Dispatch

Ehrlichia chaffeensis Infection of Sika Deer, Japan

Makoto Kawahara, Tomoko Tajima, Harumi Torii, Mitsutaka Yabutani, Joji Ishii, Makiko Harasawa, Emiko Isogai, and Yasuko RikihisaComments to Author 
Author affiliations: Nagoya City Public Health Research Institute, Nagoya, Japan (M. Kawahara, M. Yabutani, J. Ishii); Osaka Prefecture University, Sakai, Japan (T. Tajima); Nara University of Education, Nara, Japan (H. Torii); Kyoto University, Kyoto, Japan (M. Harasawa); Health Sciences University of Hokkaido, Tobetsu, Japan (E. Isogai); The Ohio State University, Columbus, Ohio, USA (Y. Rikihisa)

Main Article

Table

Detection of 16S rRNA gene and groEL gene of Ehrlichia chaffeensisin in sika deer, Japan

Target gene 1st PCR or nested PCR Primer ID Product size, bp Sequence of primers (5′ → 3′) No. positive
16S rRNA
1st NS16SCH1F 1195 ACGGACAATTGCTTATAGCCTT 7
NS16SCH1R ACAACTTTTATGGATTAGCTAAAT
Nested
NS16SCH2F 443
GGGCACGTAGGTGGACTAG 36
NS16SCH2R
CCTGTTAGGAGGGATACGAC
groEL gene 1st NSgroCH1F 849 GTTGTAACTGGTGAACAACTC 4
NSgroCH1R CTTTTCTTCTATCACCAAACCC
Nested NSgroCH2F 469 GTTCGTATTTTGGAAGATGCTG 35
NSgroCH2R ACTGTGATAACTCCATCCTTAC

Main Article

TOP