Volume 15, Number 4—April 2009
THEME ISSUE
The Amazon Region
Research
Human Febrile Illness Caused by Encephalomyocarditis Virus Infection, Peru
Table
Oligonucleotide primers used for cardiovirus PCR amplification and sequencing*
| Primer | Sequence (5′ → 3′) | Region | Coordinates | Reference |
|---|---|---|---|---|
| AN312 | GARTVWCGYRAAGRAAGCAGT | 5′-NTR | 455–475 | This study |
| AN315 | GGYRCTGGGGTTGYRCCGC | 5′-NTR | 618–600 | This study |
| AN283 | GCAGACGGWTGGGTNACNGTNTGG | VP3 | 2559–2582 | This study |
| AN285 | AGAGTAACCTCTACRTCRCAYTTRTA | VP1 | 3097–3072 | This study |
| AN393 | TTTCCACTCAAGTCTAARCARGAYT | VP1 | 3015–3049 | This study |
| AN286 | AAGAAGACAGTCGGACGNGGRCARAANAC | VP1 | 3472–3444 | This study |
| P1 | CCCTACCTCACGGAATGGGGCAAAG | 3D | 7655–7631 | (24) |
| P2 | GGTGAGAGCAAGCCTCGCAAAGACAG | 3D | 7370–7395 | (24) |
*NTR, nontranslated region; VP1, viral protein 1.


