Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 6—June 2009

Research

Hantaviruses in Rodents and Humans, Inner Mongolia Autonomous Region, China

Yong-Zhen ZhangComments to Author , Feng-Xian Zhang, Na Gao, Jian-Bo Wang, Zhi-Wei Zhao, Ming-Hui Li, Hua-Xin Chen, Yang Zou, and Alexander Plyusnin
Author affiliations: Chinese Center for Disease Control and Prevention, Changping, Beijing, People’s Republic of China (Y.-Z. Zhang, F.-X. Zhang, N. Gao, M.-H. Li, H.-X. Chen, Y. Zou); Huhehaote Center for Disease Control and Prevention, Huhehaote, Inner Mongolia Autonomous Region, People’s Republic of China (F.-X. Zhang); Yakeshi Center for Disease Control and Prevention,Yakeshi, Inner Mongolia Autonomous Region, People’s Republic of China (J.-B. Wang); Bayannaoer Center for Disease Control and Prevention, Bayannaoer, Inner Mongolia Autonomous Region, People’s Republic of China (Z.-W. Zhao); Haartman Institute, University of Helsinki, Helsinki, Finland (A. Plyusnin)

Main Article

Table 1

Specific primers used to detect hantavirus RNA in rodents, Inner Mongolia Autonomous Region, China, 2003–2006*

Type Primer Sequence (5′ → 3′) Segment† Reference
P14 TAGTAGTAGACTCC L, M, S (16)
HV-SFO GGCCAGACAGCAGATTGG S (+) (17)
HV-SRO AGCTCAGGATCCATGTCATC S (–) (17)
HTNV HSF AACAAGAGGAAGGCAAACAAC S (+) (18)
HSR GCCCCAAGCTCAGCAATACC S (–) (18)
SEOV SEO-SF TGCCAAACGCCCAATCCA S (+) (18)
SEO-SR GCCATCCCTCCGACAAACAA S (–) (18)

*HTNV, Hantaan virus; SEOV, Seoul virus.
†The hantavirus genome consists of 3 segments defined as small (S), medium (M), and large (L). The segments encode the nucleocapsid protein, 2 envelope glycoproteins, and viral RNA-dependent RNA polymerase, respectively.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO