Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 7—July 2009

Dispatch

WU Polyomavirus in Patients Infected with HIV or Hepatitis C Virus, Connecticut, USA, 2007

Michael A. Miller, Carla Weibel, David Ferguson, Marie L. Landry, and Jeffrey S. KahnComments to Author 
Author affiliations: Yale University School of Medicine, New Haven, Connecticut, USA

Main Article

Table 1

Primers used in PCR to detect WU polyomavirus in serum specimens, Connecticut, USA, 2007

Primer Name Sequence (5′ → 3′) Genome coordinates
1 WU2F* GCGCATCAAGAGGCACAGCTACTATTTC 1377–1400
2 WU2R* GCGCCTAGCCTGTGAACTCCATC 1510–1528
3 WUoriFnest† CTCATTTCCCCCTTTGTCAGGATG 5011–5034
4 WUoriRII† CTTTCCGCTGGACTACAAAGGGC 317–339
5 WUoriF† GTAAATTTCCCCAGCAGGTC 5075–5095
6 WUoriR† CGGAAACTTTAAAAGGTCACAG 153–174

*Primers used by Wattier et al. (6).
†The amplicon generated with these primer spans across nt 1 of the 5,229-bp circular virus genome.

Main Article

TOP