Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 8—August 2009

Research

Entomologic and Virologic Investigation of Chikungunya, Singapore

Lee-Ching NgComments to Author , Li-Kiang Tan, Cheong-Huat Tan, Sharon S.Y. Tan, Hapuarachchige C. Hapuarachchi, Kwoon-Yong Pok, Yee-Ling Lai, Sai-Gek Lam-Phua, Göran Bucht, Raymond T.P. Lin, Yee-Sin Leo, Boon-Hian Tan, Hwi-Kwang Han, Peng-Lim S Ooi, Lyn James, and Seow-Poh Khoo
Author affiliations: National Environment Agency, Singapore (L.-C. Ng, L.-K. Tan, C.-H. Tan, S.S.Y. Tan, H.C. Hapuarachchi, K.-Y. Pok, Y.-L. Lai, S.-G. Lam-Phua, G. Bucht, S.-P. Khoo); Tan Tock Seng Hospital, Singapore (R.T.P. Lin, Y.-S. Leo); Ministry of Health, Singapore (B.-H. Tan, H.-K. Han, P.-L. S. Ooi, L. James)

Main Article

Table 1

Primers for DNA template synthesis and sequencing of chikungunya virus, Singapore*

Name/genomic position† Sequence (5′ → 3′)
ChikE1/9870F ACAAGCCCTTATTCCGCTG
ChikE1/9994F TACGAACACGTAACAGTGATC
ChikE1/10246F TACCCATTTATGTGGGGC
ChikE1/10378F GCATCAGCTAAGCTCCGC
ChikE1/10397R ACGCGGAGCTTAGCTGAT
ChikE1/10521R ACCTTTGTACACCACAATT
ChikE1/10643F CACAACTGGTACTGCAGAGACC
ChikE1/10710R GCCAGATGGTGCCTGAGA
ChikE1/10965F GAAAGGCAAGTGTGCGGT
ChikE1/10993R TCATCGAATGCACCGCAC
ChikE1/11232F CACGGGAGGTGTGGGAC
ChikE1/11238R TCCCGTGATCTTCTGCACC
ChikE1/11359R GTGTGTCTCTTAGGGGACACATA

*Chik, chikungunya; F, forward primer; R, reverse primer.
†Genomic position of chikungunya virus (GenBank accession no. DQ443544.2) to which the first base (5′ end) of the primer corresponds.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO