Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 3—March 2010

Dispatch

Rickettsia helvetica in Patient with Meningitis, Sweden, 2006

Kenneth NilssonComments to Author , Karin Elfving, and Carl Påhlson
Author affiliations: Uppsala University Hospital, Uppsala, Sweden (K. Nilsson, K. Elfving,); Mälardalens University, Eskilstuna, Sweden (C. Påhlson); Center of Clinical Research Dalarna, Falun, Sweden (K. Nilsson); Falu Hospital, Falun (K. Nilsson, K. Elfving)

Main Article

Table

Selected inner primers and probe used to amplify genes from cerebrospinal fluid of patient with subacute meningitis, Sweden, 2006*

Gene Primers and probe Nucleotide sequences, 5′ → 3′ Product size, bp
ompB
ompB-IF
CCAATGGCAGGACTTAGCTACT
267

ompB-IR
AGGCTGGCTGATACACGGAGTAA

17 kDa
RH 17-IF
GCATTACTTGGTTCTCAATTGG
214

RH 17-IR
AACCGTAATTGCCGTTATCCGG

16SrDNA
Ric-F
TCTAGAACGAACGCTATCGGTAT
757

Ric-R
TTTCATCGTTTAACGGCGTGGACT

gltA
SFG-CS-F
TGCCAAATGTTCACGGTACTTT
74

SFG-CS-R
CACAATGGAAAGAAATGCACGA

SFG-CS-Probe TGCAATAGCAAGAACCGTAGGCTGGATG

*ompB, outer membrane protein B; gtlA, citrate synthase.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO