Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 3—March 2010

Research

Blood Meal Analysis to Identify Reservoir Hosts for Amblyomma americanum Ticks

Brian F. AllanComments to Author , Lisa S. Goessling, Gregory A. Storch, and Robert E. Thach
Author affiliations: Washington University in St. Louis, St. Louis, Missouri, USA (B.F. Allan, L.S. Goessling, R.E. Thach); St. Louis Children’s Hospital, St. Louis (G.A. Storch)

Main Article

Table 1

Oligonucleotide sequences of bacterial probes used in reverse line blot assay

Probe ID Nucleotide sequence (5′ → 3′) Target organism (RNA genes) Reference sequence
Ptg011 aacatgaacatctaaaaacataaa Borrelia garinii (23S–5S) *
Ptg012 aacatttaaaaaataaattcaagg B. afzelii (23S–5S) *
Ptg013 cattaaaaaaatataaaaaataaatttaagg B. valaisiana (23S–5S) *
Ptg009 ctttgaccatatttttatcttcca B. burgdorferi s.l. (23S––5S) *
Ptg010 aacaccaatatttaaaaaacataa B. burgdorferi s.s. (23S–5S) *
Ptg003 cgaacttctgggtcaagac B. burgdorferi s.l. (16S)
Ptg020 agataactactctccgtttg B. lonestari (16S) AY166715
Ptg022 tcctaatagggggagtc Ehrlichia chaffeensis (16S) M73222
Ptg023 cttttaacagagggagtca E. ewingii (16S) M73227
Ptg024 tcctaacagggggagtc E. canis/ovina/muris (16S) AY394465, AY318946, ABO13009
Ptg007 tggggattttttatctctgtg Anaplasma phagocytophilum (16S)
Ptg021 ctaccactgacgctgat Rickettsia rickettsii (16S) DQ150694
Ptg027 cttcggaacgcagtgac Francisella tularensis + F. philomiragia (16S) Z21932, Z21933
Ptg026 cttggggaggacgttac F. tularensis subsp. tularensis (16S) Z21932
Ptg029 gcctatragttaatagcttgt F. philomiragia (16S) Z21933
Ptg028 tcctgcgatctttctaga F. endosymbiont of Dv (16S) AF166256
Ptg032 catccagggaagtaagc Arsenophonus spp. (16S) AY265347
Ptg030 gctacaactgacactgatg R. endosymbiont of Dv (16S) AY375427
Ptg031 tacaactgacgctaatgc R. amblyommii + Rickettsia sp. (16S) U11012
Ptg035 tcggaagattatctttcgg R. amblyommii (16S) U11012

*Designed by Rijpkema et al. 1995 (23).
†Designed by Pichon et al. 2003 (13).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO