Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 4—April 2010

Research

Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India

Silvana Reißmann, Claudia Friedrichs, Reena Rajkumari, Andreas Itzek, Marcus Fulde, Arne C. Rodloff, Kootallur N. Brahmadathan, Gursharan S. Chhatwal, and D. Patric Nitsche-SchmitzComments to Author 
Author affiliations: Helmholtz Centre for Infection Research, Braunschweig, Germany (S. Reißmann, A. Itzek, M. Fulde, G.S. Chhatwal, D.P. Nitsche-Schmitz); University Hospital Leipzig, Leipzig, Germany (C. Friedrichs, A.C. Rodloff); Christian Medical College, Vellore, Tamil Nadu, India (R. Rajkumari, K.N. Brahmadathan)

Main Article

Table 1

Sequences of primers used in study of groups C and G streptococci, Vellore, India, and Leipzig, Germany*

Name Sequence (5′ → 3′) Application
16S rDNA fwd AGAGTTTGATCCTGGCTC 16S rDNA amplification
16S rDNA rev
GGTTACCTTGTTACGACTT
Primer 1 TATTCGCTTAGAAAATTAA emm amplification
Primer 2
GCAAGTTCTTCAGCTTGTTT
M13 rev CAATTTCACACAGGAAACAGCTATGAC Sequencing of 1.1-kb fragment of moac
M13 fwd
GTAAAACGACGGCCAGTGAATTG
moac1 CAAGGAATTGATTCAGCAACAGTGC Inverse PCR and sequencing of moac
moac3 CTTCTCAACAAGCATTGGCAGATGC
moac6 GTGTGTATACACGTCGGACATTTCC
moac7 GGTACAGTAATGGGAAGTTTGTTAGG
moac8 GCGGATTGACTTCATTTGGCGTCG
moac9 GGTTTGGGGATGTCTTCTTCCATGG
moac10 GCATCTCAAATCAGACGAGCAAGC
moac11 CTTGAACTTGTCTTCGCATGGAGC
moac12 GACTATTATCAAACGGTATTTGCTCG
moac2 CCAATTCACTTGAATTGACGAATCC
moac4 GCCCAACCTGAAGACAGTTGAGC
moac5 CTGACGAAAAGAGAGCCAGATATCC
moac13 CTGATACCATAATCTGACATCACTGC
moac14
GAAGTTGAACTATCTCCAATCACCG
moac-SP ATGAAAAAATCCATTCTAAATAAGGATATC Screening for 3,272-bp fragment of moac
moac-TMH7
AAGACTGGCACAAGATATAC
moac-BamH1 GCGGATCCGGTCATTTTCCAAGCAAGG Screening for 962-bp fragment of moac
moac-Sal1 GCTGTCGACTTATTAAATTCAGCCTGCTTTTTCTCC

*moac, marker of Streptococcus anginosus and S. constellatus.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO